BBa_K1475904 1 BBa_K1475904 p(tetR) repressible promoter and RBS 2014-10-16T11:00:00Z 2015-05-08T01:10:40Z - This part contains the p(tetR) repressible promoter and an artificial RBS. false false _1854_ 0 20911 9 It's complicated false - false Daniel Weltz Pedersen component2424623 1 BBa_R0040 component2424629 1 BBa_B0030 annotation2424629 1 BBa_B0030 range2424629 1 63 77 annotation2424623 1 BBa_R0040 range2424623 1 1 54 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1702 1 RBS range1702 1 8 12 annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1701 1 RBS-1\Strong range1701 1 1 15 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986785 1 -35 range1986785 1 20 25 annotation1986786 1 TetR 2 range1986786 1 26 44 annotation1986787 1 -10 range1986787 1 43 48 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986784 1 BBa_R0040 range1986784 1 1 54 BBa_K1475904_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagattaaagaggagaaa BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_B0030_sequence 1 attaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z