BBa_K1478000 1 BBa_K1478000 Expa4 plant secretion signal, localizes to extracellular space 2014-09-12T11:00:00Z 2015-05-27T02:12:26Z Derived from Expansin4 from Arabidopsis thaliana(NP_181500). Coding region for first 20 aminoacids of plant protein Exansin4. Secretion signal for plants (derived from A. thaliana). When fused to a protein, directs the protein to extracellular space. false false _1858_ 4206 20973 9 In stock false Sequence was optimized for Escherichia coli and Arabidopsis thaliana codon usage. false Fabian Fr??mling BBa_K1478000_sequence 1 atggctattaaactagcaattctatttaccacatttgttctttttagcctcgccgacgct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z