BBa_K1483003 1 Intein Ssp GyrB Split Intein 2014-10-05T11:00:00Z 2015-05-08T01:10:41Z Intein of DNA grase subunit B of the cyanobacterium Synechocystis species, strain PCC6804. Sequence optimized for codon usage in E. coli K12 and synthesised. N-Intein part of the ssp GyrB split intein. Can be used in conjunction with the 6 amino acid long C-Intein to N-terminally immobilize a peptide onto a matrix. For immobilisation, parts need to be fused to the C-terminus of the N-intein. The N-terminus of the C-Intein is fused the matrix. The split intein recombines and splices itself out, thereby specificially immobilising the N-terminus of the peptide to the matrix. The sequence of the corresponding C-Intein is: H2N-GVPVHN-COOH (was aquired by peptide synthesis and is thus not part of the registry) This part can also be used in order to create fusion proteins, by attaching the C-Intein to a proein instead of the matrix. Part in RFC25 standard. false false _1863_ 0 21259 9 In stock false Part was designed in RFC25, since it is specifically used for fusion of peptides false Nikolas Layer, Philipp H. O. Mayer and Philip Roessler annotation2396716 1 Intein range2396716 1 1 450 BBa_K1483003_sequence 1 tgcttttcgggtgacacgttggtggcgcttacagatggtcggtcagtcagcttcgagcagctcgttgaagaagaaaaacagggcaagcaaaacttctgttataccattcgccatgacggctcgattggagttgaaaagatcattaatgcccgcaaaaccaagacgaacgcgaaggtcattaaagtgaccctggataacggggagagtattatttgtacgcctgatcataagttcatgctgcgcgacgggtcatacaaatgtgctatggaccttacacttgatgactcacttatgccacttcatcgtaaaatctcaactacagaagattccggcattaccattgatggttatgaaatggtctggtcaccgcgtagcgacagttggctttttacccatctggtcgctgattggtataaccgctggcagggtatttatattgcagaagaaaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z