BBa_K1484321 1 BBa_K1484321 P_NiI3, marchantia promoter 2014-10-09T11:00:00Z 2015-06-11T01:01:00Z This part was found by screening the genome of the Marchantia polymorpha Cam strain maintained by the Haseloff lab for homologues to a Nitrate Transporter protein in A. Thaliana known as AtNRT2.2 or ACH2. Transcription is thought to be induced by nitrate (NO-3). Matches to the protein CDS sequence were found using Geneious to perform a tblastn search on the genome scaffolds. Predicted genes that contained hits graded above 30% and with at least 40% congruence to mRNA transcript sequences were shortlisted. The best gene candidates (judged according to number and distribution of hits along its length, and supporting mRNA sequence) formed the basis for our predicted promoters. This part was identified as a region upstream of the first ATG of such a gene. It has been shortened in order to omit unidentified sequence. This part is an untested potential promoter for Marchantia polymorpha. It is thought to initiate transcription of a nitrate transporter protein under conditions of limiting nitrate (NO-3). We identified the promoter during a broader search for potential inputs to our genetic circuit, and we think it may be used as such, but testing will definitely be required to confirm this. We submit this part as a foundation for future marchantia work. We were able to physically obtain DNA from a PCR of a marchantia genome. false false _1864_ 4206 21029 9 Not in stock false The removal of illegal restriction sites was considered but not completed due to direct interaction of the DNA with regulatory proteins. Also, it was ensured that the region selected for this part was directly upstream of the first ATG of the gene used to identify the promoter sequence. This was so that the 5' UTR, that is vital in plants, was maintained. false Angelina Munabi BBa_K1484321_sequence 1 tcatatattttttatatataatgctattaaaaaataaaaaattgaacttgatttaaatgtaaaactttatttcacatatttattttaaataaggattattttgttattttatttgaatattttttttacttaaaatgaaaatatttttataatatgaaattttatttataacatacatatatagattgagcttatttatgaaattaaaatttgtaaaaaattaaaaaattaaattacataatatattatcaaaattcaaaattttttaaaaattatcttaaaagaatacaacatatactgcgcatcaaaacttccaatcagggaaagagtttccgcccaaaatttctgaccatgggccccaagtttctgttttgtgacaagtggagtgagtacgaaagtcggtcggggctggccgtctatagagtccaccgatgaaggtgaagggcgatcgatggtgatgcgacgggggacacttggcagcgacgacgtcagagggggagccagggcttcgttcggttcggtctgctctggtccggtccggtggcaggaaggcgcagagggcggactcgagtgcaaagccgaggccgggggcccggagggtgctttatgtgccccacgagtcgagaccggaagacggaaggggaccagggccgcagcgcgtcgggaagttctgacgcgcccactactgaccaacagaacagatcaggtgcgcgaaagacgacggggcccgtcagagggccctcgaagccctttaaactttacctggggcattaactcgcctacttattaagccaagggaacgacaaatcggcgcacaggccctcggattgagactcggcagctgcggcaagaggaggaggaggaggaggagcacctactggtcgccttggagctctgccacgacgatagtttcgactatctttcacggatcggcagatcggcagagcgacgggggctccttgtgattctgacacac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z