BBa_K1486006 1 BBa_K1486006 IFP[1] 2014-08-24T11:00:00Z 2015-05-08T01:10:42Z From Michnick Article. To Edit This is the first part of the split infrared fluorescent protein (IFP1.4). To be used with IFP[2]. false false _1866_ 0 21033 9 Not in stock false When fused to another coding sequence, insert a flexible linker false iGem EPFL 2014 annotation2418009 1 START range2418009 1 1 3 annotation2418010 1 IFP[1] range2418010 1 1 405 annotation2418011 1 STOP range2418011 1 403 405 BBa_K1486006_sequence 1 atgtccggagctcgggaccctctgccattctttccacctctgtacctgggcggccctgagattacaaccgagaactgcgagagagagcctatccacattcctgggtccatccagccacacggggctctgctcacagctgacggccactccggagaggtgctccaagtgtccctgaatgccgctaccttcctgggccaggagcctactgtgctgcgggggcagaccctggctgccctgctccccgagcagtggccagccctgcaggcagccctgcccccaggatgtccagatgccctccaatacagggccaccctcgactggccagctgctgggcacctcagcctgactgtgcatcgggtggctgaactcctgatcctggagttcgaacctaccgaggcctggtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z