BBa_K1487006 1 BBa_K1487006 Guide RNA (gRNA) target for tcpA 2014-10-01T11:00:00Z 2015-05-08T01:10:42Z Part was assembled using complementary primers to match a 20 base pair sequence in the tcpA coding region. This part contains guide RNA (gRNA) that can target toxin coregulated pilus A (tcpA) gene. false false _1867_ 0 22722 9 Not in stock false Target sequence must be 20 base pairs and be flanked with a PAM sequence (NGG) on the 3' end in order for Cas9 + gRNA to successfully target and cleave the sequence. false Samantha Bermudez BBa_K1487006_sequence 1 ctcgaagtgatcatcgttctgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z