BBa_K1487011 1 BBa_K1487011 Guide RNA (gRNA) target for tcpF 2014-10-01T11:00:00Z 2015-05-08T01:10:43Z Part was assembled using complementary primers to match a 20 base pair sequence in the tcpF coding region. This part contains guide RNA (gRNA) that can target toxin coregulated pilus F (tcpF) gene. false false _1867_ 0 22722 9 Not in stock false Target sequence must be 20 base pairs and be flanked with a PAM sequence (NGG) on the 3' end in order for Cas9 + gRNA to successfully target and cleave the sequence. false Samantha Bermudez BBa_K1487032 1 BBa_K1487032 Promoter + Guide RNA (gRNA) target for tcpF 2014-10-02T11:00:00Z 2015-05-08T01:10:43Z Part was assembled using complementary primers to match a 20 base pair sequence in the tcpF coding region. This part contains guide RNA (gRNA) that can target toxin coregulated pilus F (tcpF) gene under strong constitutive promoter J23119. false false _1867_ 0 22722 9 It's complicated false Target sequence must be 20 base pairs and be flanked with a PAM sequence (NGG) on the 3' end in order for Cas9 + gRNA to successfully target and cleave the sequence. false Samantha Bermudez component2397597 1 BBa_K1487011 component2397596 1 BBa_J23119 annotation2397596 1 BBa_J23119 range2397596 1 1 35 annotation2397597 1 BBa_K1487011 range2397597 1 44 145 BBa_J23119 1 BBa_J23119 constitutive promoter family member 2006-08-23T11:00:00Z 2015-08-31T04:08:40Z Overlap extension of synthetic oligonucleotides Released HQ 2013 Later false true _52_ 0 483 95 In stock false N/A true John Anderson BBa_K1487011_sequence 1 taattatagttcaaccagtagttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttttt BBa_K1487032_sequence 1 ttgacagctagctcagtcctaggtataatgctagctactagagtaattatagttcaaccagtagttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttttt BBa_J23119_sequence 1 ttgacagctagctcagtcctaggtataatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z