BBa_K1489000 1 pBAD-BtGal pBAD-RBS-Bovine Galectin-1-B0012 Terminator 2014-10-05T11:00:00Z 2015-05-08T01:10:44Z Sequence generated from Bos taurus genome, reoptimized for E. coli expression. Soluble beta-galactoside binding protein (galectin) originally from Bos taurus. Believed to expressed both intracellularly and extracellularly, where they serve to binding various types of beta-galactosides and initialize signal cascades. Believed to be a dimer in its active form, as is true with most mammalian galectins. This biobrick is under the pBAD promoter (BBa_K206000) with attached RBS (BBa_B0034), and utilizes an additional RNA polymerase terminator (BBa_B0012). UMaryland 2014 is interested in utilizing this part to investigate whether E. coli can recognize and bind to surface carbohydrates on a marine pathogen. Other uses of this part lie in the recognition of various carbohydrate ligands and potential activation of signal transduction pathways. false false _1869_ 0 20382 9 It's complicated true EcoRI site in middle of Bovine Galectin gene was removed, codons were optimized for expression in E. coli. false Iowis Zhu component2397204 1 BBa_B0012 component2397198 1 BBa_K206000 component2397203 1 BBa_K1489001 component2397200 1 BBa_B0034 annotation2397200 1 BBa_B0034 range2397200 1 139 150 annotation2397203 1 BBa_K1489001 range2397203 1 157 573 annotation2397198 1 BBa_K206000 range2397198 1 1 130 annotation2397204 1 BBa_B0012 range2397204 1 582 622 BBa_K1489001 1 BtGal1 Bovine Galectin-1 2014-10-05T11:00:00Z 2015-05-08T01:10:44Z Sequence generated from Bos taurus genome, reoptimized for E. coli expression. Soluble beta-galactoside binding protein (galectin) originally from Bos taurus. Believed to expressed both intracellularly and extracellularly, where they serve to binding various types of beta-galactosides and initialize signal cascades. Believed to be a dimer in its active form, as is true with most mammalian galectins. UMaryland 2014 is interested in utilizing this part to investigate whether E. coli can recognize and bind to surface carbohydrates on a marine pathogen. Other uses of this part lie in the recognition of various carbohydrate ligands and potential activation of signal transduction pathways. false false _1869_ 0 20382 9 Not in stock false EcoRI site in middle of Bovine Galectin gene was removed, codons were optimized for expression in E. coli. false Iowis Zhu annotation2397154 1 ATG Start range2397154 1 1 3 annotation2397155 1 TGA Stop range2397155 1 415 417 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K206000 1 pBAD pBAD strong 2009-10-13T11:00:00Z 2015-05-08T01:11:23Z The sequence was obtained by applying all mutations that upregulated AraC binding and subsequent promoter activity listed in reference [1]. Released HQ 2013 pBAD is an <i>E.coli</i> promoter that is induced by L-arabinose. K206000 is a mutagenized pBAD promoter that is responsive to lower concentrations of arabinose than wild type (<partinfo>I13453</partinfo>) and, additionally, exhibits a higher maximum of protein expression as measured by coupling to a fluorescent reporter. false false _307_ 0 4172 9 In stock true There were no special design considerations. false Amelia Hardjasa annotation2049254 1 AraI2 range2049254 1 61 78 annotation2049252 1 promoter range2049252 1 1 131 annotation2049253 1 AraI1 range2049253 1 40 57 BBa_K1489001_sequence 1 atggcgtcggggcttgttgcgtccaatctgaatctgaaaccaggtgaaagcttacgcgtccgcggcgaagtagccgcagatgcgaaatcttttctcttgaacctgggcaaggacgataataatctggctttgcatttcaacccgcgtttcaacgctcatggcgacgtgaacacaatcgtgtgtaattccaaggatgctggtgcttggggtgcagaacagcgtgagtccgcgttcccgtttcaaccgggctcagttgtggaagtcaccatcagcttcaaccagaccgatctcaccattaaactgccggatggctacgagtttaagtttccaaaccgtttaaacctcgaggccatcaactatctgtccgcggggggcgacttcaagattaaaagcgtgcaccatcatcaccaccattga BBa_B0034_sequence 1 aaagaggagaaa BBa_K1489000_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcaagatagtccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagctactagagaaagaggagaaatactagatggcgtcggggcttgttgcgtccaatctgaatctgaaaccaggtgaaagcttacgcgtccgcggcgaagtagccgcagatgcgaaatcttttctcttgaacctgggcaaggacgataataatctggctttgcatttcaacccgcgtttcaacgctcatggcgacgtgaacacaatcgtgtgtaattccaaggatgctggtgcttggggtgcagaacagcgtgagtccgcgttcccgtttcaaccgggctcagttgtggaagtcaccatcagcttcaaccagaccgatctcaccattaaactgccggatggctacgagtttaagtttccaaaccgtttaaacctcgaggccatcaactatctgtccgcggggggcgacttcaagattaaaagcgtgcaccatcatcaccaccattgatactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K206000_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcaagatagtccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z