BBa_K1489001 1 BtGal1 Bovine Galectin-1 2014-10-05T11:00:00Z 2015-05-08T01:10:44Z Sequence generated from Bos taurus genome, reoptimized for E. coli expression. Soluble beta-galactoside binding protein (galectin) originally from Bos taurus. Believed to expressed both intracellularly and extracellularly, where they serve to binding various types of beta-galactosides and initialize signal cascades. Believed to be a dimer in its active form, as is true with most mammalian galectins. UMaryland 2014 is interested in utilizing this part to investigate whether E. coli can recognize and bind to surface carbohydrates on a marine pathogen. Other uses of this part lie in the recognition of various carbohydrate ligands and potential activation of signal transduction pathways. false false _1869_ 0 20382 9 Not in stock false EcoRI site in middle of Bovine Galectin gene was removed, codons were optimized for expression in E. coli. false Iowis Zhu annotation2397155 1 TGA Stop range2397155 1 415 417 annotation2397154 1 ATG Start range2397154 1 1 3 BBa_K1489001_sequence 1 atggcgtcggggcttgttgcgtccaatctgaatctgaaaccaggtgaaagcttacgcgtccgcggcgaagtagccgcagatgcgaaatcttttctcttgaacctgggcaaggacgataataatctggctttgcatttcaacccgcgtttcaacgctcatggcgacgtgaacacaatcgtgtgtaattccaaggatgctggtgcttggggtgcagaacagcgtgagtccgcgttcccgtttcaaccgggctcagttgtggaagtcaccatcagcttcaaccagaccgatctcaccattaaactgccggatggctacgagtttaagtttccaaaccgtttaaacctcgaggccatcaactatctgtccgcggggggcgacttcaagattaaaagcgtgcaccatcatcaccaccattga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z