BBa_K1489002 1 BBa_K1489002 Lpp-OmpA-Linker (pSB1C3) 2014-10-05T11:00:00Z 2015-05-08T01:10:44Z Part sequence is from BBa_K103006, which originally comes from the E. coli genome. Outer membrane protein A (OmpA) is a common outer membrane protein found in bacteria that serves various purposes. For our purposes, the beta-barrel transmembrane domain can be utilized to anchor otherwise soluble proteins in the outer cell membrane. Lpp serves to direct the fusion protein, while a unstructured linker (GGGSGGGS) serves to separate OmpA from its cargo in order to avoid interactions between the two proteins. The expressed protein is structurally identical to BBa_K103006. This version of the biobrick has been moved into the new backbone, pSB1C3, which contains the gene for chloramphenicol resistance. This resistance gene contains an internal SacI site, making the SacI site at the end of the gene almost unusable for RE cloning. BBa_K1489003 mutagenizes this SacI site into a KasI in order to avoid this issue. false false _1869_ 0 20382 9 In stock false SacI site is kept in this version of Lpp-OmpA-Linker, is removed in BBa_K1489003. false Iowis Zhu annotation2397210 1 SacI site range2397210 1 459 464 annotation2397212 1 Lpp-OmpA range2397212 1 4 438 annotation2397209 1 NdeI site range2397209 1 1 6 annotation2397208 1 ATG start range2397208 1 4 6 annotation2397211 1 Linker range2397211 1 439 464 BBa_K1489002_sequence 1 catatgaaagctactaaactggtactgggcgcggtaatcctgggttctactctgctggcaggttgctccagcaacgctaaaatcgatcagggaattaacccgtatgttggctttgaaatgggttacgactggttaggtcgtatgccgtacaaaggcagcgttgaaaacggtgcatacaaagctcagggcgttcaactgaccgctaaactgggttacccaatcactgacgacctggacatctacactcgtctgggtggcatggtatggcgtgcagacactaaatccaacgtttatggtaaaaaccacgacaccggcgtttctccggtcttcgctggcggtgttgagtacgcgatcactcctgaaatcgctacccgtctggaataccagtggaccaacaacatcggtgacgcacacaccatcggcactcgtccggacaacggcggaggttctggaggagggagctc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z