BBa_K1489003 1 BBa_K1489003 Lpp-OmpA-Linker with KasI site 2014-10-05T11:00:00Z 2015-05-08T01:10:44Z E. coli genome Outer membrane protein A (OmpA) is a common outer membrane protein found in bacteria that serves various purposes. For our purposes, the beta-barrel transmembrane domain can be utilized to anchor otherwise soluble proteins in the outer cell membrane. Lpp serves to direct the fusion protein, while a unstructured linker (GGGSGGGS) serves to separate OmpA from its cargo in order to avoid interactions between the two proteins. The expressed protein is almost structurally identical to BBa_K103006, with the terminal serine on the linker replaced by an alanine. This change was made in order to convert the previous SacI site (GAGCTC), which was unusable for RE cloning due to a second SacI site being present in the plasmid backbone, into a KasI site (GGCGCC). The KasI site codes for Gly-Ala, while the SacI site codes for Gly-Ser. This amino acid substitution is unlikely to impact the function of Lpp-OmpA-Linker in a major way. false false _1869_ 0 20382 9 It's complicated false SacI site on previous version of this biobrick was mutated into a KasI site. false Iowis Zhu annotation2397216 1 OmpA range2397216 1 6 440 annotation2397213 1 ATG Start range2397213 1 4 6 annotation2397215 1 KasI site range2397215 1 459 464 annotation2397217 1 Linker range2397217 1 441 464 annotation2397214 1 NdeI site range2397214 1 1 6 BBa_K1489003_sequence 1 catatgaaagctactaaactggtactgggcgcggtaatcctgggttctactctgctggcaggttgctccagcaacgctaaaatcgatcagggaattaacccgtatgttggctttgaaatgggttacgactggttaggtcgtatgccgtacaaaggcagcgttgaaaacggtgcatacaaagctcagggcgttcaactgaccgctaaactgggttacccaatcactgacgacctggacatctacactcgtctgggtggcatggtatggcgtgcagacactaaatccaacgtttatggtaaaaaccacgacaccggcgtttctccggtcttcgctggcggtgttgagtacgcgatcactcctgaaatcgctacccgtctggaataccagtggaccaacaacatcggtgacgcacacaccatcggcactcgtccggacaacggcggaggttctggaggaggggcgcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z