BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_K1489002 1 BBa_K1489002 Lpp-OmpA-Linker (pSB1C3) 2014-10-05T11:00:00Z 2015-05-08T01:10:44Z Part sequence is from BBa_K103006, which originally comes from the E. coli genome. Outer membrane protein A (OmpA) is a common outer membrane protein found in bacteria that serves various purposes. For our purposes, the beta-barrel transmembrane domain can be utilized to anchor otherwise soluble proteins in the outer cell membrane. Lpp serves to direct the fusion protein, while a unstructured linker (GGGSGGGS) serves to separate OmpA from its cargo in order to avoid interactions between the two proteins. The expressed protein is structurally identical to BBa_K103006. This version of the biobrick has been moved into the new backbone, pSB1C3, which contains the gene for chloramphenicol resistance. This resistance gene contains an internal SacI site, making the SacI site at the end of the gene almost unusable for RE cloning. BBa_K1489003 mutagenizes this SacI site into a KasI in order to avoid this issue. false false _1869_ 0 20382 9 In stock false SacI site is kept in this version of Lpp-OmpA-Linker, is removed in BBa_K1489003. false Iowis Zhu annotation2397212 1 Lpp-OmpA range2397212 1 4 438 annotation2397210 1 SacI site range2397210 1 459 464 annotation2397211 1 Linker range2397211 1 439 464 annotation2397209 1 NdeI site range2397209 1 1 6 annotation2397208 1 ATG start range2397208 1 4 6 BBa_K1489001 1 BtGal1 Bovine Galectin-1 2014-10-05T11:00:00Z 2015-05-08T01:10:44Z Sequence generated from Bos taurus genome, reoptimized for E. coli expression. Soluble beta-galactoside binding protein (galectin) originally from Bos taurus. Believed to expressed both intracellularly and extracellularly, where they serve to binding various types of beta-galactosides and initialize signal cascades. Believed to be a dimer in its active form, as is true with most mammalian galectins. UMaryland 2014 is interested in utilizing this part to investigate whether E. coli can recognize and bind to surface carbohydrates on a marine pathogen. Other uses of this part lie in the recognition of various carbohydrate ligands and potential activation of signal transduction pathways. false false _1869_ 0 20382 9 Not in stock false EcoRI site in middle of Bovine Galectin gene was removed, codons were optimized for expression in E. coli. false Iowis Zhu annotation2397154 1 ATG Start range2397154 1 1 3 annotation2397155 1 TGA Stop range2397155 1 415 417 BBa_K206000 1 pBAD pBAD strong 2009-10-13T11:00:00Z 2015-05-08T01:11:23Z The sequence was obtained by applying all mutations that upregulated AraC binding and subsequent promoter activity listed in reference [1]. Released HQ 2013 pBAD is an <i>E.coli</i> promoter that is induced by L-arabinose. K206000 is a mutagenized pBAD promoter that is responsive to lower concentrations of arabinose than wild type (<partinfo>I13453</partinfo>) and, additionally, exhibits a higher maximum of protein expression as measured by coupling to a fluorescent reporter. false false _307_ 0 4172 9 In stock true There were no special design considerations. false Amelia Hardjasa annotation2049252 1 promoter range2049252 1 1 131 annotation2049254 1 AraI2 range2049254 1 61 78 annotation2049253 1 AraI1 range2049253 1 40 57 BBa_K1489004 1 OmpA-BtGal pBAD-RBS-OmpA-Bovine Galectin-1-B0012 Terminator 2014-10-05T11:00:00Z 2015-05-08T01:10:44Z OmpA is from E. coli genome Bovine galectin 1 is from Bos taurus genome. A fusion protein of OmpA (BBa_K1489002) fused to Bovine Galectin-1 (BBa_K1489001). Used to bind sugars at the outer cell membrane. Under pBAD regulation. false false _1869_ 0 20382 9 It's complicated true When designing this part, had to choose between the pBAD and pLac promoters. Decided to use the pBAD promoter due to tighter regulation; we were unsure of whether the protein was toxic and did not want to have too much leaky expression. false Iowis Zhu component2397229 1 BBa_K1489002 component2397233 1 BBa_B0012 component2397223 1 BBa_B0034 component2397232 1 BBa_K1489001 component2397221 1 BBa_K206000 annotation2397232 1 BBa_K1489001 range2397232 1 629 1045 annotation2397233 1 BBa_B0012 range2397233 1 1054 1094 annotation2397229 1 BBa_K1489002 range2397229 1 159 622 annotation2397221 1 BBa_K206000 range2397221 1 1 130 annotation2397223 1 BBa_B0034 range2397223 1 139 150 BBa_K1489001_sequence 1 atggcgtcggggcttgttgcgtccaatctgaatctgaaaccaggtgaaagcttacgcgtccgcggcgaagtagccgcagatgcgaaatcttttctcttgaacctgggcaaggacgataataatctggctttgcatttcaacccgcgtttcaacgctcatggcgacgtgaacacaatcgtgtgtaattccaaggatgctggtgcttggggtgcagaacagcgtgagtccgcgttcccgtttcaaccgggctcagttgtggaagtcaccatcagcttcaaccagaccgatctcaccattaaactgccggatggctacgagtttaagtttccaaaccgtttaaacctcgaggccatcaactatctgtccgcggggggcgacttcaagattaaaagcgtgcaccatcatcaccaccattga BBa_B0034_sequence 1 aaagaggagaaa BBa_K1489004_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcaagatagtccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagctactagagaaagaggagaaatactagagcatatgaaagctactaaactggtactgggcgcggtaatcctgggttctactctgctggcaggttgctccagcaacgctaaaatcgatcagggaattaacccgtatgttggctttgaaatgggttacgactggttaggtcgtatgccgtacaaaggcagcgttgaaaacggtgcatacaaagctcagggcgttcaactgaccgctaaactgggttacccaatcactgacgacctggacatctacactcgtctgggtggcatggtatggcgtgcagacactaaatccaacgtttatggtaaaaaccacgacaccggcgtttctccggtcttcgctggcggtgttgagtacgcgatcactcctgaaatcgctacccgtctggaataccagtggaccaacaacatcggtgacgcacacaccatcggcactcgtccggacaacggcggaggttctggaggagggagctctactagatggcgtcggggcttgttgcgtccaatctgaatctgaaaccaggtgaaagcttacgcgtccgcggcgaagtagccgcagatgcgaaatcttttctcttgaacctgggcaaggacgataataatctggctttgcatttcaacccgcgtttcaacgctcatggcgacgtgaacacaatcgtgtgtaattccaaggatgctggtgcttggggtgcagaacagcgtgagtccgcgttcccgtttcaaccgggctcagttgtggaagtcaccatcagcttcaaccagaccgatctcaccattaaactgccggatggctacgagtttaagtttccaaaccgtttaaacctcgaggccatcaactatctgtccgcggggggcgacttcaagattaaaagcgtgcaccatcatcaccaccattgatactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K206000_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcaagatagtccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1489002_sequence 1 catatgaaagctactaaactggtactgggcgcggtaatcctgggttctactctgctggcaggttgctccagcaacgctaaaatcgatcagggaattaacccgtatgttggctttgaaatgggttacgactggttaggtcgtatgccgtacaaaggcagcgttgaaaacggtgcatacaaagctcagggcgttcaactgaccgctaaactgggttacccaatcactgacgacctggacatctacactcgtctgggtggcatggtatggcgtgcagacactaaatccaacgtttatggtaaaaaccacgacaccggcgtttctccggtcttcgctggcggtgttgagtacgcgatcactcctgaaatcgctacccgtctggaataccagtggaccaacaacatcggtgacgcacacaccatcggcactcgtccggacaacggcggaggttctggaggagggagctc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z