BBa_J04500 1 BBa_J04500 IPTG inducible promoter with RBS 2005-06-08T11:00:00Z 2015-08-31T04:08:14Z Davidson Synth-Aces Released HQ 2013 R0010.B0034 false true _16_ 0 326 16 In stock false false Kristen DeCelle component1508149 1 BBa_R0010 component1508159 1 BBa_B0034 annotation1508159 1 BBa_B0034 range1508159 1 209 220 annotation1508149 1 BBa_R0010 range1508149 1 1 200 BBa_K1491015 1 BBa_K1491015 Codon Optimized KillerRed 2014-08-03T11:00:00Z 2015-05-08T01:10:44Z This part was codon optimized from the original KillerRed (BBa_K1184000) This part is the codon optimized version of KillerRed (BBa_K1184000). It has been optimized for E. coli by eliminating the rare codons. false false _1871_ 0 22521 9 In stock false Increase the functionality of KillerRed through codon optimization. false Danielle Peters annotation2380344 1 6x His Tag range2380344 1 718 735 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1491016 1 BBa_K1491016 Lac Inducible Codon Optimized KillerRed 2014-08-03T11:00:00Z 2015-05-08T01:10:44Z The original KillerRed is BBa_K1184000. Codon optimized KillerRed with WTLac promoter allows for induction of KillerRed expression with IPTG. false false _1871_ 0 22521 9 In stock false Lac inducible codon optimized KillerRed false Danielle Peters component2380353 1 BBa_J04500 component2380355 1 BBa_K1491015 annotation2380355 1 BBa_K1491015 range2380355 1 227 967 annotation2380353 1 BBa_J04500 range2380353 1 1 220 BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961224 1 -35 range1961224 1 137 142 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961225 1 -10 range1961225 1 161 166 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961227 1 start range1961227 1 173 173 annotation1961223 1 CAP binding site range1961223 1 89 126 BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_B0034_sequence 1 aaagaggagaaa BBa_J04500_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaa BBa_K1491016_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagatgggcagcgaaggcggtcccgcgctgtttcaaagtgacatgacttttaaaatctttattgatggagaagttaatggacaaaagtttactattgtcgcagacggctcatccaagtttccgcatggggattttaacgtccatgcagtatgcgagacggggaaattaccgatgagctggaaaccgatctgtcatctgatccagtatggcgaaccgttctttgcacgttatcctgatggcatctctcatttcgcccaagaatgcttcccggaaggactttctattgatcgtaccgttcgctttgagaatgacggtaccatgacttctcatcacacctacgaactggatgacacctgcgtggtctctcgtatcacggtgaattgtgatggttttcagccggatggcccgatcatgcgtgaccaattggttgatattctcccgaatgagacacatatgttcccgcatgggccgaacgccgtgcgccagctggcctttatcggttttacaaccgcagatggaggtctgatgatgggtcattttgatagtaaaatgacgtttaacggctcccgtgcgatcgagattcccggtcctcacttcgttaccatcatcacgaaacagatgcgcgatacttcggataaacgcgatcatgtatgtcaacgcgaggtggcgtatgcccattccgtgccgcgcattacatctgcgatcggcagcgatgaagatcatcatcaccaccatcactaataa BBa_K1491015_sequence 1 atgggcagcgaaggcggtcccgcgctgtttcaaagtgacatgacttttaaaatctttattgatggagaagttaatggacaaaagtttactattgtcgcagacggctcatccaagtttccgcatggggattttaacgtccatgcagtatgcgagacggggaaattaccgatgagctggaaaccgatctgtcatctgatccagtatggcgaaccgttctttgcacgttatcctgatggcatctctcatttcgcccaagaatgcttcccggaaggactttctattgatcgtaccgttcgctttgagaatgacggtaccatgacttctcatcacacctacgaactggatgacacctgcgtggtctctcgtatcacggtgaattgtgatggttttcagccggatggcccgatcatgcgtgaccaattggttgatattctcccgaatgagacacatatgttcccgcatgggccgaacgccgtgcgccagctggcctttatcggttttacaaccgcagatggaggtctgatgatgggtcattttgatagtaaaatgacgtttaacggctcccgtgcgatcgagattcccggtcctcacttcgttaccatcatcacgaaacagatgcgcgatacttcggataaacgcgatcatgtatgtcaacgcgaggtggcgtatgcccattccgtgccgcgcattacatctgcgatcggcagcgatgaagatcatcatcaccaccatcactaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z