BBa_K1497003 1 BBa_K1497003 B0034-CHI - Chalcone Isomerase from Petunia with strong RBS 2014-10-10T11:00:00Z 2015-05-08T01:10:45Z Petunia The Chalcone Isomerse catalyzes the reaction from Naringenin chalcone to Naringenin. This enzyme is non-essential for flavanone pathways, because the reaction takes place independently from CHI in the cytosol. The enzyme independent reaction is catalyzed by an acidic compound. Without CHI the reaction is stereo unspecific. S-Naringenin is the active compound for the most enzymes in the biochemical pathways. To prevent gaining a racemic product and losing 50% yield, CHI is used, because only the enzyme is able to form 100 % S-Naringenin. For using the CHI in our Naringenin Operon (K1497007) we added the strong RBS B0034. false false _1877_ 0 12466 9 Not in stock false no false Sascha Hein, Niklas Hummel, Sebastian Barthel, Thomas Dohmen component2416908 1 BBa_K1497000 component2416907 1 BBa_B0034 annotation2416907 1 BBa_B0034 range2416907 1 1 12 annotation2416908 1 BBa_K1497000 range2416908 1 19 744 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1497000 1 BBa_K1497000 Chalcone Isomerase (CHI) from Petunia 2014-10-06T11:00:00Z 2015-05-08T01:10:45Z Petunia Hybrida The Chalcone Isomerse catalyzes the reaction from Naringenin chalcone to Naringenin. This enzyme is non-essential for flavanone pathways, because the reaction takes place independently from CHI in the cytosol. The enzyme independent reaction is catalyzed by an acidic compound. Without CHI the reaction is stereo unspecific. S-Naringenin is the active compound for the most enzymes in the biochemical pathways. To prevent gaining a racemic product and losing 50% yield, CHI is used, because only the enzyme is able to form 100 % S-Naringenin. Reaction of the CHI. A proton shift of naringenin chalcone builds naringenin. We used the CHI and verified the function in our Naringenin Operon (K1497007). false false _1877_ 0 12466 9 It's complicated false Original Sequence from Petunia false Sascha Hein, Niklas Hummel, Sebastian Barthel, Thomas Dohmen BBa_K1497003_sequence 1 aaagaggagaaatactagatggctcctccagtgtccgttactaaaatgcaggttgagaattacgctttcgcaccgaccgtgaaccctgctggttccaccaataccttgttccttgctggtgctgggcatagaggtctggagatagaagggaagtttgttaagtttacggcgataggtgtgtatctcgaagagagtgctattccttttctggccgaaaaatggaaaggcaaaaccccccaggagttgactgactcggtcgagttctttagggatgttgttacaggtccatttgagaaatttactcgagttactatgatcttgcccttgacgggcaagcagtactcggagaaggtggcggagaattgtgttgcgcattggaaggggataggaacgtatactgatgatgagggtcgtgccattgagaagtttctcgatgttttccggagtgaaacttttccacctggtgcttccatcatgtttactcaatcacccctagggttgttgacgattagcttcgctaaagatgattcagtaactggcactgcgaatgctgttatagagaacaagcagttgtctgaagcagtgctggaatcaataattgggaagcatggagtttctcctgcggcaaagtgtagtgtcgctgaaagagtagcggaactgctcaaaaagagctatgctgaagaggcatctgtttttggaaaaccggagaccgagaaatctactattccagtgattggagtctag BBa_K1497000_sequence 1 atggctcctccagtgtccgttactaaaatgcaggttgagaattacgctttcgcaccgaccgtgaaccctgctggttccaccaataccttgttccttgctggtgctgggcatagaggtctggagatagaagggaagtttgttaagtttacggcgataggtgtgtatctcgaagagagtgctattccttttctggccgaaaaatggaaaggcaaaaccccccaggagttgactgactcggtcgagttctttagggatgttgttacaggtccatttgagaaatttactcgagttactatgatcttgcccttgacgggcaagcagtactcggagaaggtggcggagaattgtgttgcgcattggaaggggataggaacgtatactgatgatgagggtcgtgccattgagaagtttctcgatgttttccggagtgaaacttttccacctggtgcttccatcatgtttactcaatcacccctagggttgttgacgattagcttcgctaaagatgattcagtaactggcactgcgaatgctgttatagagaacaagcagttgtctgaagcagtgctggaatcaataattgggaagcatggagtttctcctgcggcaaagtgtagtgtcgctgaaagagtagcggaactgctcaaaaagagctatgctgaagaggcatctgtttttggaaaaccggagaccgagaaatctactattccagtgattggagtctag BBa_B0034_sequence 1 aaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z