BBa_K1499251 1 BBa_K1499251 supP tRNA 2014-08-26T11:00:00Z 2015-05-08T01:10:46Z todo todo false false _1879_ 0 11095 9 It's complicated true todo false Raman Nelakanti annotation2430056 1 Internal primer bind_R range2430056 1 1 20 annotation2430059 1 supP tRNA range2430059 1 141 225 annotation2430058 1 tRNA and flanking regions range2430058 1 41 263 annotation2430057 1 Internal primer bind_F range2430057 1 21 40 annotation2430060 1 CUA anticodon range2430060 1 175 177 BBa_K1499251_sequence 1 caattccaaccgcctgaacgggggctgaacttcctgtaccactgaaaatttcagcacttagcgaggtgcgacgaagctggcgcttgcatggtggcgtgcgacaggtataatccacaacgttttccgcatacctcttcagtgccgaagtggcgaaatcggtagacgcagttgattctaaatcaaccgtagaaatacgtgccggttcgagtccggccttcggcaccaaaagtatgtaaatagacctcaactgaggtcttttttcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z