BBa_K150105 1 BBa_K150105 linkerHD05 2008-10-20T11:00:00Z 2015-05-08T01:10:47Z - - false false _234_ 0 3309 9 Not in stock false - false Maximilian H??rner BBa_K150002 1 BBa_K150002 Chloramphenicol resistance 2008-10-20T11:00:00Z 2015-05-08T01:10:46Z pDEST15, Invitrogen coding sequence of chloramphenicol resistance gene false false _234_ 0 3309 9 Not in stock false - false Maximilian H??rner BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1709 1 RBS-3\Weak range1709 1 1 13 annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1710 1 RBS range1710 1 7 10 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_K150003 1 BBa_K150003 Chloramphenicol resistance cassette 2008-10-20T11:00:00Z 2015-05-08T01:10:46Z - Chloramphenicol resistance cassette includes promotor, RBS, coding sequence and terminator false false _234_ 0 3309 9 It's complicated false - false Maximilian Hoerner, Christian Moritz, Anna Stoeckl, Yin Cai, Stephen Kraemer component1983312 1 BBa_B0012 component1983301 1 BBa_J23101 component1983311 1 BBa_K150100 component1983309 1 BBa_B0010 component1983304 1 BBa_B0032 component1983307 1 BBa_K150002 component1983308 1 BBa_K150106 component1983302 1 BBa_K150100 component1983306 1 BBa_K150105 annotation1983304 1 BBa_B0032 range1983304 1 44 56 annotation1983309 1 BBa_B0010 range1983309 1 730 809 annotation1983306 1 BBa_K150105 range1983306 1 57 63 annotation1983302 1 BBa_K150100 range1983302 1 36 43 annotation1983301 1 BBa_J23101 range1983301 1 1 35 annotation1983307 1 BBa_K150002 range1983307 1 64 723 annotation1983312 1 BBa_B0012 range1983312 1 818 858 annotation1983311 1 BBa_K150100 range1983311 1 810 817 annotation1983308 1 BBa_K150106 range1983308 1 724 729 BBa_K150106 1 BBa_K150106 linkerHD06 2008-10-20T11:00:00Z 2015-05-08T01:10:47Z - - false false _234_ 0 3309 9 Not in stock false - false Maximilian H??rner BBa_J23101 1 BBa_J23101 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z later Released HQ 2013 later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_K150100 1 BBa_K150100 linkerHD00 2008-10-20T11:00:00Z 2015-05-08T01:10:47Z - original scar from BioBricks false false _234_ 0 3314 9 Not in stock false - false Christian Moritz BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K150100_sequence 1 tactagag BBa_K150003_sequence 1 tttacagctagctcagtcctaggtattatgctagctactagagtcacacaggaaagtgctaaaatggagaaaaaaatcactggatataccaccgttgatatatcccaatggcatcgtaaagaacattttgaggcatttcagtcagttgctcaatgtacctataaccagaccgttcagctggatattacggcctttttaaagaccgtaaagaaaaataagcacaagttttatccggcctttattcacattcttgcccgcctgatgaatgctcatccggagttccgtatggcaatgaaagacggtgagctggtgatatgggatagtgttcacccttgttacaccgttttccatgagcaaactgaaacgttttcatcgctctggagtgaataccacgacgatttccggcagtttctacacatatattcgcaagatgtggcgtgttacggtgaaaacctggcctatttccctaaagggtttattgagaatatgtttttcgtctcagccaatccctgggtgagtttcaccagttttgatttaaacgtggccaatatggacaacttcttcgcccccgttttcaccatgggcaaatattatacgcaaggcgacaaggtgctgatgccgctggcgattcaggttcatcatgccgtttgtgatggcttccatgtcggcagaatgcttaatgaattacaacagtactgcgatgagtggcagggcggggcgtaaaagcttccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0032_sequence 1 tcacacaggaaag BBa_K150002_sequence 1 atggagaaaaaaatcactggatataccaccgttgatatatcccaatggcatcgtaaagaacattttgaggcatttcagtcagttgctcaatgtacctataaccagaccgttcagctggatattacggcctttttaaagaccgtaaagaaaaataagcacaagttttatccggcctttattcacattcttgcccgcctgatgaatgctcatccggagttccgtatggcaatgaaagacggtgagctggtgatatgggatagtgttcacccttgttacaccgttttccatgagcaaactgaaacgttttcatcgctctggagtgaataccacgacgatttccggcagtttctacacatatattcgcaagatgtggcgtgttacggtgaaaacctggcctatttccctaaagggtttattgagaatatgtttttcgtctcagccaatccctgggtgagtttcaccagttttgatttaaacgtggccaatatggacaacttcttcgcccccgttttcaccatgggcaaatattatacgcaaggcgacaaggtgctgatgccgctggcgattcaggttcatcatgccgtttgtgatggcttccatgtcggcagaatgcttaatgaattacaacagtactgcgatgagtggcagggcggggcgtaa BBa_K150105_sequence 1 tgctaaa BBa_J23101_sequence 1 tttacagctagctcagtcctaggtattatgctagc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K150106_sequence 1 aagctt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z