BBa_K150102 1 BBa_K150102 linkerHD02 2008-10-20T11:00:00Z 2015-05-08T01:10:47Z - linker sequence used in BBa_K150004 false false _234_ 0 3314 9 Not in stock false - false Christian Moritz BBa_K150004 1 BBa_K150004 lambda cI generator 2008-10-20T11:00:00Z 2015-05-08T01:10:46Z - Lambda cI generator consisting of a strong constitutive promotor (BBa_J23101), a strong ribosome binding site (BBa_B0034), a lambda cI coding sequence (BBa_K150001) and a double terminator (BBa_B0015). The lambda cI coding sequence was optimized for high expression levels in E. coli false false _234_ 0 3314 9 It's complicated false - false Christian Moritz, Maximilian Hoerner, Anna Stoeckl, Yin Cai, Stephen Kraemer component1983343 1 BBa_K150100 component1983335 1 BBa_B0032 component1983340 1 BBa_K150101 component1983337 1 BBa_K150102 component1983341 1 BBa_B0010 component1983339 1 BBa_K150001 component1983344 1 BBa_B0012 component1983333 1 BBa_K150103 component1983332 1 BBa_J23101 annotation1983341 1 BBa_B0010 range1983341 1 785 864 annotation1983332 1 BBa_J23101 range1983332 1 1 35 annotation1983335 1 BBa_B0032 range1983335 1 44 56 annotation1983344 1 BBa_B0012 range1983344 1 873 913 annotation1983333 1 BBa_K150103 range1983333 1 36 43 annotation1983343 1 BBa_K150100 range1983343 1 865 872 annotation1983340 1 BBa_K150101 range1983340 1 777 784 annotation1983337 1 BBa_K150102 range1983337 1 57 62 annotation1983339 1 BBa_K150001 range1983339 1 63 776 BBa_K150001 1 BBa_K150001 lambda cI 2008-10-20T11:00:00Z 2015-05-08T01:10:46Z aminoacid sequence from: NP_040628 and NC_001416 Coding region for the cI repressor based on cI repressor aminoacid sequence from bacteriophage lambda. The nucleotide sequence was optimized for high expression levels in E. coli using Geneart's GeneOptimizer technology. false false _234_ 0 3314 9 Not in stock false - false Christian Moritz annotation1983143 1 lambda cI range1983143 1 1 714 BBa_K150101 1 BBa_K150101 linkerHD01 2008-10-20T11:00:00Z 2015-05-08T01:10:47Z - linker sequence used in BBa_K15004 false false _234_ 0 3314 9 Not in stock false - false Christian Moritz BBa_K150103 1 BBa_K150103 linkerHD03 2008-10-20T11:00:00Z 2015-05-08T01:10:47Z - linker sequence used in BBa_K150004 false false _234_ 0 3314 9 Not in stock false - false Christian Moritz BBa_J23101 1 BBa_J23101 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z later Released HQ 2013 later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1709 1 RBS-3\Weak range1709 1 1 13 annotation1710 1 RBS range1710 1 7 10 annotation7027 1 BBa_B0032 range7027 1 1 13 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_K150100 1 BBa_K150100 linkerHD00 2008-10-20T11:00:00Z 2015-05-08T01:10:47Z - original scar from BioBricks false false _234_ 0 3314 9 Not in stock false - false Christian Moritz BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K150102_sequence 1 ggtacc BBa_K150101_sequence 1 gagctcag BBa_K150100_sequence 1 tactagag BBa_K150004_sequence 1 tttacagctagctcagtcctaggtattatgctagctagagctctcacacaggaaagggtaccatgagcaccaaaaaaaaaccgctgacccaagaacagctggaagatgcgcgtcgtctgaaagcgatctacgaaaaaaaaaaaaacgaactgggcctgagccaggaaagcgttgcggataaaatgggcatgggccagagcggtgtgggtgcgctgtttaacggcattaacgcgctgaacgcgtataacgctgctctgctggccaaaattctgaaagtgagcgtggaagaatttagcccgagcattgcacgcgaaatctacgaaatgtatgaagcggtgagcatgcagccgagcctgcgtagcgaatatgaatatccggtgtttagccatgtgcaggcaggcatgttttctccggaactgcgtacctttaccaaaggtgatgcggaacgttgggtgagcaccaccaaaaaagcgagcgatagcgcgttttggctggaagtggaaggcaacagcatgaccgcaccgaccggcagcaaaccgagctttccggatggcatgctgattctggtggatccggaacaggcggtggaaccgggtgatttttgcattgcgcgtctgggtggtgatgagttcaccttcaaaaaactgattcgtgatagcggtcaggtgtttctgcaaccgctgaatccgcagtatccgatgattccgtgcaacgaaagctgtagcgtggtgggcaaagtgattgcgagccagtggccggaagaaacctttggctaagagctcagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0032_sequence 1 tcacacaggaaag BBa_K150001_sequence 1 atgagcaccaaaaaaaaaccgctgacccaagaacagctggaagatgcgcgtcgtctgaaagcgatctacgaaaaaaaaaaaaacgaactgggcctgagccaggaaagcgttgcggataaaatgggcatgggccagagcggtgtgggtgcgctgtttaacggcattaacgcgctgaacgcgtataacgctgctctgctggccaaaattctgaaagtgagcgtggaagaatttagcccgagcattgcacgcgaaatctacgaaatgtatgaagcggtgagcatgcagccgagcctgcgtagcgaatatgaatatccggtgtttagccatgtgcaggcaggcatgttttctccggaactgcgtacctttaccaaaggtgatgcggaacgttgggtgagcaccaccaaaaaagcgagcgatagcgcgttttggctggaagtggaaggcaacagcatgaccgcaccgaccggcagcaaaccgagctttccggatggcatgctgattctggtggatccggaacaggcggtggaaccgggtgatttttgcattgcgcgtctgggtggtgatgagttcaccttcaaaaaactgattcgtgatagcggtcaggtgtttctgcaaccgctgaatccgcagtatccgatgattccgtgcaacgaaagctgtagcgtggtgggcaaagtgattgcgagccagtggccggaagaaacctttggctaa BBa_J23101_sequence 1 tttacagctagctcagtcctaggtattatgctagc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K150103_sequence 1 tagagctc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z