BBa_K1502002 1 BBa_K1502002 accB portion of Acyl-CoA Ligase 2014-10-16T11:00:00Z 2015-05-08T01:10:47Z This part was isolated through PCR from the pACM4-ACA plasmid ordered from AddGene. This sequence codes for the accB protein. This must be combined with accA,accC, and accD in order to come together to produce the acyl-CoA ligase enzyme. This enzyme takes in free fatty acids and produces fatty acyl-CoA's. false false _1882_ 0 22463 9 Not in stock false The PCR process included X and P overhangs in order to include into the pSB1C3 plasmid. false Matthew Ykema annotation2427074 1 Start codon range2427074 1 1 3 BBa_K1502002_sequence 1 atggatattcgtaagattaaaaaactgatcgagctggttgaagaatcaggcatctccgaactggaaatttctgaaggcgaagagtcagtacgcattagccgtgcagctcctgccgcaagtttccctgtgatgcaacaagcttacgctgcaccaatgatgcagcagccagctcaatctaacgcagccgctccggcgaccgttccttccatggaagcgccagcagcagcggaaatcagtggtcacatcgtacgttccccgatggttggtactttctaccgcaccccaagcccggacgcaaaagcgttcatcgaagtgggtcagaaagtcaacgtgggcgataccctgtgcatcgttgaagccatgaaaatgatgaaccagatcgaagcggacaaatccggtaccgtgaaagcaattctggtcgaaagtggacaaccggtagaatttgacgagccgctggtcgtcatcgagtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z