BBa_K1506000 1 rareGFP Superfolder GFP with only rare codons 2014-08-04T11:00:00Z 2015-05-08T01:10:47Z This is a purely synthetic part. This part is a reporter gene for green florescent protein. It has the same amino acid sequence as superfolder GFP (part_) but is comprised only of rare codons. false false _1886_ 0 22551 9 Not in stock false The codon optimization that was used when designing this sequence was based on the codon usage profile for E. coli across its entire genome. To produce any particular amino acid, E. coli can usually use one of several codons, because of codon redundancy. Previous researchers compiled a table showing the frequency with which each codon appears in the entire genome and organized the data to show which codons are the most commonly and most rarely used to produce any given amino acid. To create this GFP, the rarest possible codon was used for each amino acid in the protein. false Clay Swackhamer, Sam Krug, Ashlee Smith, Emily Sileo annotation2380376 1 start codon range2380376 1 1 3 annotation2380378 1 two stop codons range2380378 1 774 780 annotation2380379 1 Leader Sequence same for all 5 variant GFPs) range2380379 1 4 63 annotation2380377 1 rare GFP cds range2380377 1 64 774 BBa_K1506000_sequence 1 atgcacaaaactgttcgtgctgttcgtcagaaagttcacaaatctactgttcagactctcgagaggaagggagaggagctattcactggagtagtacccatactagtagagctagacggagacgtaaatggacacaagttctcagtaaggggagagggagagggagacgctactaatggaaagctaactctaaagttcatatgtactactggaaagctacccgtaccctggcccactctagtaactactctaacttacggagtacaatgtttcgctaggtaccccgaccacatgaagcaacacgacttcttcaagtcagctatgcccgagggatacgtacaagagaggactatatcattcaaggacgacggaacttacaagactagggctgaggtaaagttcgagggagacactctagtaaataggatagagctaaagggaatagacttcaaggaggacggaaatatactaggacacaagctagagtacaatttcaattcacacaatgtatacataactgctgacaagcaaaagaatggaataaaggctaatttcaagataaggcacaatgtagaggacggatcagtacaactagctgaccactaccaacaaaatactcccataggagacggacccgtactactacccgacaatcactacctatcaactcaatcagtactatcaaaggaccccaatgagaagagggaccacatggtactactagagttcgtaactgctgctggaataactcacggaatggacgagctatacaagtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z