BBa_K1506001 1 BBa_K1506001 Superfolder GFP with only common codons 2014-08-04T11:00:00Z 2015-05-08T01:10:47Z This part is entirely synthetic. This part is a reporter gene producing green florescent protein. It is translated to the same amino acid sequence as superfolder GFP false false _1886_ 0 22551 9 Not in stock false This GFP codes for the same green florescent protein as superfolder GFP, but it is comprised only of common codons. Previous researchers have determined through a statistical analysis of the entire genome of E. coli that some degenerate codons occur more often in protein coding sequences and some are more infrequent. These are referred to as common and rare codons. The hypothesis that common codons will lead to higher expression of proteins is based on the idea that cellular DNA has become optimized through evolution to efficiently translate proteins necessary to their survival. For each amino acid coded by this GFP, the most commonly occurring codon in the genome of E. coli that specifies that amino acid was used, thus creating a coding sequence of only common codons. false Clay Swackhamer, Sam Krug, Ashlee Smith, Emily Sileo annotation2380375 1 Leader Sequence same for all 5 variant GFPs) range2380375 1 4 63 annotation2380372 1 start codon range2380372 1 1 3 annotation2380374 1 common GFP CDS range2380374 1 64 774 annotation2380373 1 two stop codons range2380373 1 775 780 BBa_K1506001_sequence 1 atgcacaaaactgttcgtgctgttcgtcagaaagttcacaaatctactgttcagactctcgagcgtaaaggcgaagaactgtttaccggcgtggtgccgattctggtggaactggatggcgatgtgaacggccataaatttagcgtgcgtggcgaaggcgaaggcgatgcgaccaacggcaaactgaccctgaaatttatttgcaccaccggcaaactgccggtgccgtggccgaccctggtgaccaccctgacctatggcgtgcagtgctttgcgcgttatccggatcatatgaaacagcatgatttttttaaaagcgcgatgccggaaggctatgtgcaggaacgtaccattagctttaaagatgatggcacctataaaacccgtgcggaagtgaaatttgaaggcgataccctggtgaaccgtattgaactgaaaggcattgattttaaagaagatggcaacattctgggccataaactggaatataactttaacagccataacgtgtatattaccgcggataaacagaaaaacggcattaaagcgaactttaaaattcgtcataacgtggaagatggcagcgtgcagctggcggatcattatcagcagaacaccccgattggcgatggcccggtgctgctgccggataaccattatctgagcacccagagcgtgctgagcaaagatccgaacgaaaaacgtgatcatatggtgctgctggaatttgtgaccgcggcgggcattacccatggcatggatgaactgtataaataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z