BBa_K1506002 1 Fast Super Optimized Superfolder GFP - only fast codons 2014-09-30T11:00:00Z 2015-05-08T01:10:47Z We designed the coding sequence in MatLab using the software to break up the initial coding sequence and then substitute each codon for the fastest translation rate for that specific amino acid. After these were designed, we ordered them as gBLOCKS from IDT DNA. Superfolder GFP has been modified so that the coding sequence contains all "fast" codons. The reason that we designed this version of superfolder GFP was to explore the possibilities with codon optimization. Currently, codon optimization focuses on whether the relative abundance of a codon in the genome. We have decided to extend this to whether codons for the specific amino acid are considered to have a fast translation rate or a slow translation rate; this variation of superfolder GFP has the fast coding sequence. We have modified the superfolder GFP so that there can be more expression of superfolder GFP. false false _1886_ 0 22557 9 It's complicated true Our definition of fast codons was based on current research being done in our lab. There is data to support this definition and this is what we used to design the experiment. false Sam Krug, Clay Swackhamer, Ashlee Smith, Emily Sileo annotation2391579 1 BBa_I746916 range2391579 1 1 720 annotation2391577 1 superfolder GFP coding region range2391577 1 1 720 annotation2391578 1 stop range2391578 1 715 720 annotation2391576 1 start range2391576 1 1 3 BBa_K1506002_sequence 1 atgcgtaaaggtgaagaactgttcactggtgttgttccgatcctggttgaactggacggtgacgttaacggtcacaaattctctgttcgtggtgaaggtgaaggtgacgctactaacggtaaactgactctgaaattcatctgcactactggtaaactgccggttccgtggccgactctggttactactctgacttacggtgttcagtgcttcgctcgttacccggaccacatgaaacagcacgacttcttcaaatctgctatgccggaaggttacgttcaggaacgtactatctctttcaaagacgacggtacttacaaaactcgtgctgaagttaaattcgaaggtgacactctggttaaccgtatcgaactgaaaggtatcgacttcaaagaagacggtaacatcctgggtcacaaactggaatacaacttcaactctcacaacgtttacatcactgctgacaaacagaaaaacggtatcaaagctaacttcaaaatccgtcacaacgttgaagacggttctgttcagctggctgaccactaccagcagaacactccgatcggtgacggtccggttctgctgccggacaaccactacctgtctactcagtctgttctgtctaaagacccgaacgaaaaacgtgaccacatggttctgctggaattcgttactgctgctggtatcactcacggtatggacgaactgtacaaataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z