BBa_K1507019 1 BBa_K1507019 PhoA signal sequence 2014-10-06T11:00:00Z 2015-05-08T01:10:47Z E.coli PhoA is a gene that functions as a signal sequence in E.coli. Ligating this signal sequence before a protein coding region can enable the protein to be carried to the cell membrane and secreted to extracellular environment. false false _1887_ 0 23158 9 It's complicated false No data false Willy Hsu BBa_K1507019_sequence 1 atgaaacagagcaccattgcgctggcgctgctgccgctgctgtttaccccggtgaccaaagcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z