BBa_K1507021 1 BBa_K1507021 Skin whitening substance generator (OmpA signal sequence + PKEK) 2014-10-06T11:00:00Z 2015-05-08T01:10:47Z E.coli Artificial synthesis In E.coli Type II secretion system, the signal sequence(In here is OmpA) can bring the target protein to the inner-membrane， and transfer the target protein to the outer space. There are many candidates sequence for guiding or protein product, so we choose three of them(All of them have been studied for a long period of time by other laboratory), to make sure the signal sequence is suit for the transportation of our target proteins. PKEK, comprise of Pro-Lys-Glu-Lys, is a tetraoligopeptide that has the strong effect of whitening our skin. By down-regulating the mRNA expression of interleukin (IL)-6, IL-8 and TNF-α and tyrosinase, it can prevent the formation of eumelanin. Another advantage why we choose PKEK is it can easily penetrate the skin barrier and have its maximum false false _1887_ 0 23158 9 Not in stock false No data false Willy Hsu BBa_K1507021_sequence 1 atgaaaaaaaccgcgattgcgattgcggtggcgctggcgggctttgcgaccgtggcgcaggcgccgaaagaaaaata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z