BBa_K1508002 1 BBa_K1508002 IIA(Glc) - E.coli glucose-specific phosphotransferase enzyme IIA 2014-10-08T11:00:00Z 2015-05-08T01:10:47Z Escherichia coli DH5alpha genome Phosphotransferase system (PTS) is a major carbohydrate active -transport system, which is executed by a cascade of protein rally. For glucose uptake, IIA(Glc) is the only enzyme specific to glucose transport. We measure the concentration of glucose in the medium using catabolite repression mechanism toward lacI promoter activity upstream of a reporter gene, mRFP. We expect by over-expressing IIA(Glc) in E. coli, we will obtain different range of glucose standard curve in our measurement system. false false _1888_ 0 16581 9 In stock true The gene coding for IIA(Glc) from E.coli - crr - was isolated by colony PCR using forward primer which contains with restriction sites of EcoRI and XbaI and reverse primers which contains restriction site for SpeI and a double stop codon. false Fahmi Dwilaksono, Indah Nurulita, Rian Adha Ardinata, Mochammad Isro Alfajri, Arief Budi Witarto annotation2407417 1 IIA(Glc) coding region range2407417 1 1 513 annotation2407420 1 TAA TAA stop codon range2407420 1 508 513 annotation2407415 1 ATG start codon range2407415 1 1 3 BBa_K1508002_sequence 1 atgggtttgttcgataaactgaaatctctggtttccgacgacaagaaggataccggaactattgagatcattgctccgctctctggcgagatcgtcaatatcgaagacgtgccggatgtcgtttttgcggaaaaaatcgttggtgatggtattgctatcaaaccaacgggtaacaaaatggtcgcgccagtagacggcaccattggtaaaatctttgaaaccaaccacgcattctctatcgaatctgatagcggcgttgaactgttcgtccacttcggtatcgacaccgttgaactgaaaggcgaaggcttcaagcgtattgctgaagaaggtcagcgcgtgaaagttggcgatactgtcattgaatttgatctgccgctgctggaagagaaagccaagtctaccctgactccggttgttatctccaacatggacgaaatcaaagaactgatcaaactgtccggtagcgtaaccgtgggtgaaaccccggttatccgcatcaagaagtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z