BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_K1508003 1 BBa_K1508003 IIA(Glc) + double terminator 2014-10-08T11:00:00Z 2015-05-08T01:10:47Z IIA(Glc) gene from Escherichia coli; double terminator from iGEM Registry E. coli IIA(Glc) gene (BBa_K1508002) followed by double terminator (BBa_B0015) false false _1888_ 0 16581 9 In stock true Construct was assembled by suffix insertion, namely BBa_B0015 fragment was inserted into BBa_K1508002 backbone. false Fahmi Dwilaksono, Indah Nurulita, Rian Adha Ardinata, Mochammad Isro Alfajri, Arief Budi Witarto component2407582 1 BBa_B0015 component2407575 1 BBa_K1508002 annotation2407582 1 BBa_B0015 range2407582 1 522 650 annotation2407575 1 BBa_K1508002 range2407575 1 1 513 BBa_K1508002 1 BBa_K1508002 IIA(Glc) - E.coli glucose-specific phosphotransferase enzyme IIA 2014-10-08T11:00:00Z 2015-05-08T01:10:47Z Escherichia coli DH5alpha genome Phosphotransferase system (PTS) is a major carbohydrate active -transport system, which is executed by a cascade of protein rally. For glucose uptake, IIA(Glc) is the only enzyme specific to glucose transport. We measure the concentration of glucose in the medium using catabolite repression mechanism toward lacI promoter activity upstream of a reporter gene, mRFP. We expect by over-expressing IIA(Glc) in E. coli, we will obtain different range of glucose standard curve in our measurement system. false false _1888_ 0 16581 9 In stock true The gene coding for IIA(Glc) from E.coli - crr - was isolated by colony PCR using forward primer which contains with restriction sites of EcoRI and XbaI and reverse primers which contains restriction site for SpeI and a double stop codon. false Fahmi Dwilaksono, Indah Nurulita, Rian Adha Ardinata, Mochammad Isro Alfajri, Arief Budi Witarto annotation2407417 1 IIA(Glc) coding region range2407417 1 1 513 annotation2407420 1 TAA TAA stop codon range2407420 1 508 513 annotation2407415 1 ATG start codon range2407415 1 1 3 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1508003_sequence 1 atgggtttgttcgataaactgaaatctctggtttccgacgacaagaaggataccggaactattgagatcattgctccgctctctggcgagatcgtcaatatcgaagacgtgccggatgtcgtttttgcggaaaaaatcgttggtgatggtattgctatcaaaccaacgggtaacaaaatggtcgcgccagtagacggcaccattggtaaaatctttgaaaccaaccacgcattctctatcgaatctgatagcggcgttgaactgttcgtccacttcggtatcgacaccgttgaactgaaaggcgaaggcttcaagcgtattgctgaagaaggtcagcgcgtgaaagttggcgatactgtcattgaatttgatctgccgctgctggaagagaaagccaagtctaccctgactccggttgttatctccaacatggacgaaatcaaagaactgatcaaactgtccggtagcgtaaccgtgggtgaaaccccggttatccgcatcaagaagtaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1508002_sequence 1 atgggtttgttcgataaactgaaatctctggtttccgacgacaagaaggataccggaactattgagatcattgctccgctctctggcgagatcgtcaatatcgaagacgtgccggatgtcgtttttgcggaaaaaatcgttggtgatggtattgctatcaaaccaacgggtaacaaaatggtcgcgccagtagacggcaccattggtaaaatctttgaaaccaaccacgcattctctatcgaatctgatagcggcgttgaactgttcgtccacttcggtatcgacaccgttgaactgaaaggcgaaggcttcaagcgtattgctgaagaaggtcagcgcgtgaaagttggcgatactgtcattgaatttgatctgccgctgctggaagagaaagccaagtctaccctgactccggttgttatctccaacatggacgaaatcaaagaactgatcaaactgtccggtagcgtaaccgtgggtgaaaccccggttatccgcatcaagaagtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z