BBa_K1509000 1 BBa_K1509000 Coding for the trans-acting regulator SmtB 2014-09-25T11:00:00Z 2015-07-23T03:26:04Z Metallothioneins(MTs), discovered in horse kidney in 1957 by Margoshes and Vallee are identified as low-molecular weight and sulphydryl rich proteins which bind metal ions in metal-thiolate clusters and whose synthesis increases in response to elevated concentrations of certain metals. In 1988, Olafson and co-workers reported the amino acid sequence of a metal-associated protein isolated from cyanobacterium Synechococcus sp.. With the function of binding metal ions remaining, it only has less than 20% homology in amino acid sequence with known MTs in eukaryotes and thus we call it class II MT or on some occasions MT-like. Owing to the works of Robinson and Huckle, the corresponding locus of Synechococcus PCC7942, smt locus was isolated and analyzed. It includes smtA which encodes the class II MT and a divergently transcribed gene smtB which encodes a trans-acting, autoregulatory repressor that exerts metal ion-inducible negative control over smtA transcription. Between them lies a 100-bp operator-promoter region(smt O-P, BBa_K1509001), which is responsible for the divergent orientation of smtA and smtB. In 1993, Huckle and co-workers reported the isolation and analysis of the smt locus from Synechococcus sp.. Gene smtB, one of the components of the locus, encodes a transcriptional repressor of gene smtA, with which is required for normal tolerance to Zn2+ and Cd2+. The product of smtB functions by binding to the smt operator-promoter(smtO-P) and dissociating in the presence of Zn2+ due to the classical helix-turn-helix motif similar to many DNA-binding proteins. It can also be genomically rearranged when induced by Cd2+, leading to a deletion within smtB because of a highly iterated palindrome (HIP1), a highly represented octanucleotides(5′-GCGATC-GC-3′) which traverse both borders of the excised element. These two mechanisms both cause the elevated expression of smtA. false false _1889_ 4206 24032 9 In stock false According to the mechanisms of smt locus represented above, gene smtB should function with the accompany of smt operator-promoter. Previous cases selected smtA whose product functions by encoding MT-like to sequester metal ions, while our case intended to take advantage of the trigger lies in this locus. By imitating former researches, in which a promoter less lacZ gene was fused upstream of smtA, we respectively splice two selected reporter genes and sequence from smt operator-promoter to smtB, equivalent to replacing smtA with reporter genes, to visualize the effects of metal ions on the locus. false Tong Li annotation2387081 1 smtB range2387081 1 1 301 BBa_K1509000_sequence 1 ctagcgacactcttgtaagtgatcgagggcgttttgataaagcgccacaatgtgatgatcctgtagctggtagtagacatgccgcccttgcttgcgatagctcaccagccgcagattacggagcgatcgcaattggtgagacaccgccgattcggaaacaccaattgcctgggccaaatccccaacacagagctccgatcgcgctaacagggacagcaaccgcagtcgatttggatcggccagcactgcaaaaaattcggctagcgattgggcaacttcgggtgcgatcgcttgaagctccgaggcgatcgccgcatgagtcccttggcagactaccgtctctccgtcctgcagcactggttttgtcat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z