BBa_K1509001 1 BBa_K1509001 A bi-directional promoter affected by SmtB protein 2014-09-26T11:00:00Z 2015-07-23T03:26:53Z smt O-P is a part of smt locus from Synechococcus PCC7942. smt O-P is a promoter which has two inverted repeats, designated S1/S2 and S3/S4, in the overlapping promoter/operator sites between gene smtA and gene smtB. The full promoter/operator DNA binds two SmtB dimmers forming a S1/S2-SmtB:SmtB-S3/S4 bridge complex. After binding with smtB, smt O-P represses the expression of downstream genes. false false _1889_ 4206 24032 9 In stock false We got smt O-P and smtA, a fragment coding MT-like to sequester metal ions from smt locus by PCR and overlaped two fragments,smtB-smt O-P and pigment gene.Binding with smtB, smt O-P represses the expression of reporter genes.In the presence of heavy metal,the pigment and SmtA can expression normally. false Tong Li annotation2387085 1 smt O-P range2387085 1 1 100 BBa_K1509001_sequence 1 gagccaatcacggtttgtccacccaccatacctgaatcaagattcagatgttaggctaaacacatgaacagttattcagatattcaaaggagttgctgtc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z