BBa_K1509003 1 BBa_K1509003 CP25 is a highly active,constitutive promoter 2014-09-25T11:00:00Z 2015-05-08T01:10:47Z We synthesized CP25 from a library of synthetic promoters for Lactococcus lactis. The synthetic CP25 promoter was designed to be constitutive. CP25 is a stronge promoter in Lactococcus lactis by Jensen and Hammer.In the article,they measure the activities of the CP promoter in E. coli.The promoter activities were assayed from the expression of a reporter gene (lacLM) encoding β-galactosidase transcribed from the different synthetic promoter clones on the promoter cloning vector pAK80.The result suggests CP25 is the strongest promoter. false false _1889_ 0 24032 9 In stock false CP25 was used as the strong constitutive promoter to regulate the expression of the gene CDS7. false Tong Li annotation2386929 1 CP25 range2386929 1 1 59 BBa_K1509003_sequence 1 ctttggcagtttattcttgacatgtagtgagggggctggtataatcacatagtactgtt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z