BBa_K1510002 1 BBa_K1510002 PnlmC (S.mutans) 2014-10-05T11:00:00Z 2015-05-08T01:10:47Z Streptococcus mutans UA159 This part is derived from Streptococcus mutans UA159, a gram positive bacterium. The main function of this promoter is to sense a quorum sensing chemical, competence-stimulating peptide (CSP), and trigger down string gene. false false _1890_ 0 21272 9 In stock false Since there is no accurate description of actual position of nlmC promoter in previous study, to ensure the function of this promoter, we amplified the sequence from two comE binding site( used for detecting CSP) to the last nucleotide before gene nlmC. As a result, the gene sequence consists of two comE binding site, nlmC promoter and RBS. false Yen-An Chang annotation2424695 1 comE binding site range2424695 1 11 21 annotation2425447 1 -10 extend region range2425447 1 69 76 annotation2425417 1 comE binding site range2425417 1 32 42 annotation2425446 1 -35 extend region range2425446 1 48 53 BBa_K1510002_sequence 1 atcaaaaatgaccgtttaggacaaaatagctaccatttaggatattttgctccattttgaaaataaattgttatactagagatgtcggttgcgcagccagacaaaaaactaaaaatggggaaggggtatttatcat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z