BBa_K1510100 1 BBa_K1510100 constitutive promoter (veg promoter) in S.mutans 2014-10-05T11:00:00Z 2015-05-08T01:10:48Z streptococcus mutans constitutive promoter (veg promoter) in S.mutans false false _1890_ 0 21299 9 Not in stock false To achieve best efficiency, we also consider the spacer between promoter and coding sequence without RBS(because our final product is RNA) false Wei-Tai Chen annotation2396754 1 EcoRI site range2396754 1 4 9 BBa_K1510006 1 BBa_K1510006 sRNA targets histidine kinase 11 in S.mutans 2014-10-05T11:00:00Z 2015-05-08T01:10:47Z constitutive promoter(veg promoter) is came from Bacillus subtilis, and MicC scaffold is came from E.coli k-12 MG1655. Other parts are synthesized by primer. veg promoter(constitutive promoter in S.mutans+ Histidine kinase 11 sRNA+ MicC scaffold+ terminator. Constitutive promoter(veg promoter) is came from Bacillus subtilis, and MicC scaffold is came from E.coli k-12 MG1655.Other parts are synthesized by primer. This part will transcibe into sRNA, and sRNA will bind to mRNA of HK11, prevent HK11 mRNA from translating. Because histidine kinase 11 is a biofilm formation-related protein, this part is created to decrease biofilm formation. false false _1890_ 0 21299 9 Not in stock false Because we need to put our part into vector PVA838 to shuttle plasmid between E.coli and S.mutans. The restriction site before part is EcoRI and BamHI in the last. In addition, to achieve best efficiency, we also consider the spacer between promoter and coding sequence without RBS(because our final product is RNA) false Wei-Tai Chen component2396766 1 BBa_K1510103 component2396767 1 BBa_K1510104 component2396764 1 BBa_K1510100 component2396765 1 BBa_K1510101 annotation2396764 1 BBa_K1510100 range2396764 1 1 50 annotation2396765 1 BBa_K1510101 range2396765 1 59 82 annotation2396767 1 BBa_K1510104 range2396767 1 178 199 annotation2396766 1 BBa_K1510103 range2396766 1 91 169 BBa_K1510101 1 BBa_K1510101 sRNA targets histidine kinase 11 mRNA in S.mutans 2014-10-05T11:00:00Z 2015-05-08T01:10:48Z primer sRNA targets histidine kinase 11 in S.mutans false false _1890_ 0 21299 9 Not in stock false complementary to histidine kinase 11 false Wei-Tai Chen BBa_K1510103 1 BBa_K1510103 MicC scaffold from E.coli MG1655 2014-10-05T11:00:00Z 2015-05-08T01:10:48Z E.coli MG1655 MicC scaffold from E.coli MG1655, it is a RNA sequence and can recruit Hfq protein in sRNA gene knockdown mechanism. false false _1890_ 0 21299 9 It's complicated false No false Wei-Tai Chen BBa_K1510104 1 BBa_K1510104 terminator in S.mutans 2014-10-05T11:00:00Z 2015-05-08T01:10:48Z primer terminator in S.mutans false false _1890_ 0 21299 9 Not in stock false It has BamHI cutting cite in the last false Wei-Tai Chen annotation2396768 1 BamHI cutting site range2396768 1 14 19 BBa_K1510100_sequence 1 ccggaattcttgacaaaaatgggctcgtgttgtacaataaatgtaatgca BBa_K1510101_sequence 1 agcggttaaaattaaagtccacat BBa_K1510103_sequence 1 tttctgttgggccattgcattgccactgattttccaacatataaaaagacaagcccgaacagtcgtccgggcttttttt BBa_K1510104_sequence 1 cagctgatagctgggatccaca BBa_K1510006_sequence 1 ccggaattcttgacaaaaatgggctcgtgttgtacaataaatgtaatgcatactagagagcggttaaaattaaagtccacattactagagtttctgttgggccattgcattgccactgattttccaacatataaaaagacaagcccgaacagtcgtccgggcttttttttactagagcagctgatagctgggatccaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z