BBa_K1510007 1 BBa_K1510007 sRNA targets G protein mRNA in S.mutans 2014-10-05T11:00:00Z 2015-05-08T01:10:47Z constitutive promoter(veg promoter) is came from Bacillus subtilis, and MicC scaffold is came from E.coli k-12 MG1655. Other parts are synthesized by primer. veg promoter(constitutive promoter in S.mutans+ G protein sRNA+ MicC scaffold+ terminator. Constitutive promoter(veg promoter) is came from Bacillus subtilis, and MicC scaffold is came from E.coli k-12 MG1655.Other parts are synthesized by primer. This part will transcibe into sRNA, and sRNA will bind to mRNA of SGP(S.mutans G protein), prevent SGP mRNA from translating. Because G protein is a biofilm formation-related protein, this part is created to decrease biofilm formation. false false _1890_ 0 21299 9 In stock false Because we need to put our part into vector PVA838 to shuttle plasmid between E.coli and S.mutans. The restriction site before part is EcoRI and BamHI in the last. In addition, to achieve best efficiency, we also consider the spacer between promoter and coding sequence without RBS(because our final product is RNA) false Wei-Tai Chen annotation2396887 1 terminator range2396887 1 145 157 annotation2396882 1 Veg promoter range2396882 1 1 36 annotation2396886 1 MicC scaffold range2396886 1 66 144 annotation2396884 1 sRNA targets G protein range2396884 1 42 65 BBa_K1510007_sequence 1 ttgacaaaaatgggctcgtgttgtacaataaatgtaatgcaagcggttaaaattaaagtccacattttctgttgggccattgcattgccactgattttccaacatataaaaagacaagcccgaacagtcgtccgggctttttttcagctgatagctg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z