BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K1510008 1 BBa_K1510008 E.coli Signal sequence YebF 2014-10-05T11:00:00Z 2015-05-08T01:10:48Z The promoter, J23100, comes from the 2014 distributed igem kit. The signal sequence, yebF, encoding signal protein exporting recombinant protein extracellular, is from E.coli K-12. By designing primer, we obtain it together with its naturally occurring ribosomal binding site using PCR and extraction. Finally, the terminator B0015 is from 2014 igem distribution. This part is composed with a strong promoter, together with ribosomal binding site and signal sequence yebF, finally a double terminator. As a signal protein, YebF would be secreted outside E.coli. The role of the circuit in our project is basically a control circuit. By contrasting the result of this circuit and the other circuit, containing functional protein, we can assume if the protein works more accurately. false false _1890_ 0 21268 9 In stock false To fit igem part standard, the circuit is constructed in backbone pSB1C3, chloramphenicol with EcoR1 and Xba1 in front of the part, and Spe1, Pst1 behind the part. false Chien-Yung Huang component2396753 1 BBa_J23100 annotation2396753 1 BBa_J23100 range2396753 1 1 35 BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_K1510008_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z