BBa_K1510100 1 BBa_K1510100 constitutive promoter (veg promoter) in S.mutans 2014-10-05T11:00:00Z 2015-05-08T01:10:48Z streptococcus mutans constitutive promoter (veg promoter) in S.mutans false false _1890_ 0 21299 9 Not in stock false To achieve best efficiency, we also consider the spacer between promoter and coding sequence without RBS(because our final product is RNA) false Wei-Tai Chen annotation2396754 1 EcoRI site range2396754 1 4 9 BBa_K1510100_sequence 1 ccggaattcttgacaaaaatgggctcgtgttgtacaataaatgtaatgca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z