BBa_K1510102 1 BBa_K1510102 sRNA targets G protein mRNA in S.mutans 2014-10-05T11:00:00Z 2015-05-08T01:10:48Z primer sRNA targets G protein mRNA in S.mutans false false _1890_ 0 21299 9 Not in stock false complementary to G protein mRNA in S.mutans false Wei-Tai Chen BBa_K1510102_sequence 1 tacaaatcctgatttaaatgacat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z