BBa_K1510104 1 BBa_K1510104 terminator in S.mutans 2014-10-05T11:00:00Z 2015-05-08T01:10:48Z primer terminator in S.mutans false false _1890_ 0 21299 9 Not in stock false It has BamHI cutting cite in the last false Wei-Tai Chen annotation2396768 1 BamHI cutting site range2396768 1 14 19 BBa_K1510104_sequence 1 cagctgatagctgggatccaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z