BBa_K1510105 1 BBa_K1510105 sRNA targets histidine kinase 11 mRNA in S.mutans 2014-10-05T11:00:00Z 2015-05-08T01:10:48Z Veg promoter+HK11 sRNA+MicC scaffold+terminator veg promoter(constitutive promoter in S.mutans+ Histidine kinase 11 sRNA+ MicC scaffold+ terminator. Constitutive promoter(veg promoter) is came from Bacillus subtilis, and MicC scaffold is came from E.coli k-12 MG1655.Other parts are synthesized by primer. This part will transcibe into sRNA, and sRNA will bind to mRNA of HK11, prevent HK11 mRNA from translating. Because histidine kinase 11 is a biofilm formation-related protein, this part is created to decrease biofilm formation. false false _1890_ 0 21299 9 In stock false Because we need to put our part into vector PVA838 to shuttle plasmid between E.coli and S.mutans. The restriction site before part is EcoRI and BamHI in the last. In addition, to achieve best efficiency, we also consider the spacer between promoter and coding sequence without RBS(because our final product is RNA) false Wei-Tai Chen annotation2396863 1 Veg promoter range2396863 1 1 36 annotation2396865 1 MicC sacffold range2396865 1 66 144 annotation2396866 1 terminator range2396866 1 145 157 annotation2396864 1 sRNA targets histidine kinase 11 range2396864 1 42 65 BBa_K1510105_sequence 1 ttgacaaaaatgggctcgtgttgtacaataaatgtaatgcaagcggttaaaattaaagtccacattttctgttgggccattgcattgccactgattttccaacatataaaaagacaagcccgaacagtcgtccgggctttttttcagctgatagctg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z