BBa_K1510114 1 BBa_K1510114 C16 is a signal peptide that binds to the surface of Streptococcus Mutants. 2014-10-06T11:00:00Z 2015-05-08T01:10:48Z We derive our C16 peptide from the genome of Streptococcus Mutants UA159. C16 is a competent signaling peptide that uniquely belongs to Streptococcus Mutants, which is the dominant pathogen in our mouth. The Streptococcus Mutants often use C16 as a finger-print to recognize each other, and also a C16 can bind to the surface receptor of Streptococcus Mutants. Therefore, we use an anchor protein to grab C16 on our E.coli surface, in the hope of attaching our E.coli to the Streptococcus pathogens. false false _1890_ 0 21271 9 It's complicated false wait for further information false Kao Jung Chang BBa_K1510114_sequence 1 acatttttccggctgtttaacagaagttttacacaagctttgggaaaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z