BBa_K592006 1 BBa_K592006 FixK2 promoter 2011-09-16T11:00:00Z 2015-05-08T01:12:48Z FixK2 promoter omes from the genome of Bradyrhizobium japonicum. Released HQ 2013 FixK2 promoter is the wild-type promoter to which phospho-FixJ binds. FixJ in turn can be regulated by YF1, the blue light-sensing protein. This promoter shows very little leaky activity in the absence of FixJ. false false _763_ 0 7929 9 In stock false The sequence information was provided by Moffat (Moffat et al. 2009). The DNA was synthesized by GenScript. false Lei Sun annotation2130179 1 FixK2 promoter range2130179 1 1 250 BBa_K145151 1 ccdB ccdB coding region 2008-08-06T11:00:00Z 2015-07-08T03:14:50Z P1010 Released HQ 2013 Coding region for the ccdB (control of cell death) gene. true false _257_ 4206 2970 9 In stock true just one stop codon in the end true Jonas Demeulemeester annotation1970252 1 stop range1970252 1 304 306 annotation1970253 1 cds range1970253 1 1 303 annotation1970251 1 start range1970251 1 1 3 BBa_K1510233 1 BBa_K1510233 A blue light regulated ccdb apoptosis gene 2014-10-06T11:00:00Z 2015-05-08T01:10:48Z The blue light promoter was derived from igem kit : K592006. And the ccdb gene was K145151. This is a composite of two units, a blue light promoter and a ccdb killing gene. The blue light promoter may turn on the transcription of ccdb. And what ccdb does, is to generate DNA binding sequences which led to DNA polymerase dysfunction. And gradually leads to cell death caused by mitosis failure. false false _1890_ 0 21271 9 It's complicated false Whether the blue light promoter is strong enough to turn on enough ccdb gene, and whether ccdb efficiency greater than cell division ability. false Kao Jung Chang component2404332 1 BBa_K145151 component2404328 1 BBa_K592006 annotation2404332 1 BBa_K145151 range2404332 1 257 562 annotation2404328 1 BBa_K592006 range2404328 1 1 250 BBa_K145151_sequence 1 atgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataa BBa_K1510233_sequence 1 gccggagccgattatccgcacccgtccttggtcttggacacactcgctcgcgatccgaagccgcctttcaaagatactccgcagtgaaacgcatcttttaagcgcgacttgtcgccttcgcgcagcagaacactcgtatggcactcaatccatgatcgcttcgttcgctccgacgcgcgttgcggggcccccctcgaccggatgacaacacattgcgtcacctcaactgctgcgcgcgcactgcgtcacatactagatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataa BBa_K592006_sequence 1 gccggagccgattatccgcacccgtccttggtcttggacacactcgctcgcgatccgaagccgcctttcaaagatactccgcagtgaaacgcatcttttaagcgcgacttgtcgccttcgcgcagcagaacactcgtatggcactcaatccatgatcgcttcgttcgctccgacgcgcgttgcggggcccccctcgaccggatgacaacacattgcgtcacctcaactgctgcgcgcgcactgcgtcaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z