BBa_K1510904 1 BBa_K1510904 Truncated lysostaphin coding circuit 2014-10-07T11:00:00Z 2015-05-08T01:10:48Z The promoter, J23100, comes from the 2014 distributed igem kit. The signal sequence, yebF, encoding signal protein exporting recombinant protein extracellular, is from E.coli K-12. By designing primer, we obtain it together with its naturally occurring ribosomal binding site using PCR and extraction.The truncated lysostaphin coding sequence is from 2013 igem distribution. Finally, the terminator B0015 is from 2014 igem distribution we use truncated lysostaphin coding sequence(designed by HIT-Harbin 2012 igem team) to reach our goal deplete biofilm formed by streptococcus mutans. YebF,a signal protein, would be secreted outside E.coli to make protein works more accurately. false false _1890_ 0 21271 9 It's complicated false To fit igem part standard, the circuit is constructed in backbone pSB1C3, chloramphenicol with EcoR1 and Xba1 in front of the part, and Spe1, Pst1 behind the part. false Kao Jung Chang component2404687 1 BBa_J23100 component2404696 1 BBa_B0015 component2404688 1 BBa_K1510009 component2404689 1 BBa_K748002 annotation2404687 1 BBa_J23100 range2404687 1 1 35 annotation2404696 1 BBa_B0015 range2404696 1 1340 1468 annotation2404689 1 BBa_K748002 range2404689 1 591 1331 annotation2404688 1 BBa_K1510009 range2404688 1 44 584 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_K748002 1 BBa_K748002 Truncated lysostaphin coding sequence. Lysostaphin has has a specific lytic action against S.aureus. 2012-09-14T11:00:00Z 2015-05-08T01:13:12Z de novo synthesis Released HQ 2013 Lysostaphin is a zinc metalloenzyme that has a specific lytic action against S.aureus. Lysostaphin has activities of three enzymes namely, endo-&#946;-N-acetyl glucosamidase, N-acteyl-muramyl-L-alanine amidase, glycylglycine endopeptidase. Glycylglycine endopeptidase lyses staphylococcal cells by hydrolyzing glycylglycine bonds in the poly-glycine bridges which form cross links between glycopeptide chains in cell wall peptidoglycan of S.aureus cells. The wild-type lysostaphin gene encodes a preproenzyme, and the conversion of prolysostaphin to mature lysostaphin occurs extracellularly and involves the removal of the hydrophilic tandem repeat portion of the proenzyme. In order to directly produce mature lysostaphin, we truncate the preprolysostaphin and prolysostaphin sequence. false false _999_ 0 8564 9 In stock false In order to directly produce mature lysostaphin, we truncate the preprolysostaphin and prolysostaphin sequence. false Lei Qiao BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K1510009 1 BBa_K1510009 E.coli Signal sequence YebF 2014-10-05T11:00:00Z 2015-05-08T01:10:48Z The promoter, J23100, comes from the 2014 distributed igem kit. The signal sequence, yebF, encoding signal protein exporting recombinant protein extracellular, is from E.coli K-12. By designing primer, we obtain it together with its naturally occurring ribosomal binding site using PCR and extraction. Finally, the terminator B0015 is from 2014 igem distribution. This part is composed with a strong promoter, together with ribosomal binding site and signal sequence yebF, finally a double terminator. As a signal protein, YebF would be secreted outside E.coli. The role of the circuit in our project is basically a control circuit. By contrasting the result of this circuit and the other circuit, containing functional protein, we can assume if the protein works more accurately. false false _1890_ 0 21268 9 It's complicated false To fit igem part standard, the circuit is constructed in backbone pSB1C3, chloramphenicol with EcoR1 and Xba1 in front of the part, and Spe1, Pst1 behind the part. false Chien-Yung Huang BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1510904_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagttgacggctagctcagtcctaggtacagtgctagctactagggagaaaaacatgaaaaaaagaggggcgtttttagggctgttgttggtttctgcctgcgcatcagttttcgctgccaataatgaaaccagcaagtcggtcactttcccaaagtgtgaagatctggatgctgccggaattgccgcgagcgtaaaacgtgattatcaacaaaatcgcgtggcgcgttgggcagatgatcaaaaaattgtcggtcaggccgatcccgtggcttgggtcagtttgcaggacattcagggtaaagatgataaatggtcagtaccgctaaccgtgcgtggtaaaagtgccgatattcattaccaggtcagcgtggactgcaaagcgggaatggcggaatatcagcggcgtactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagatgacacatgaacattcagcacaatggttgaataattacaaaaaaggatatggttacggtccttatccattaggtataaatggcggtatgcactacggagttgatttttttatgaatattggaacaccagtaaaagctatttcaagcggaaaaatagttgaagctggttggagtaattacggaggaggtaatcaaataggtcttattgaaaatgatggagtgcatagacaatggtatatgcatctaagtaaatataatgttaaagtaggagattatgtcaaagctggtcaaataatcggttggtctggaagcactggttattctacagcaccacatttacacttccaaagaatggttaattcattttcaaattcaactgcccaagatccaatgcctttcttaaagagcgcaggatatggaaaagcaggtggtacagtaactccaacgccgaatacaggttggaaaacaaacaaatatggcacactatataaatcagagtcagctagcttcacacctaatacagatataataacaagaacgactggtccatttagaagcatgccgcagtcaggagtcttaaaagcaggtcaaacaattcattatgatgaagtgatgaaacaagacggtcatgtttgggtaggttatacaggtaacagtggccaacgtatttacttgcctgtaagaacatggaataaatctactaatactttaggtgttctttggggaactataaagtaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1510009_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagggagaaaaacatgaaaaaaagaggggcgtttttagggctgttgttggtttctgcctgcgcatcagttttcgctgccaataatgaaaccagcaagtcggtcactttcccaaagtgtgaagatctggatgctgccggaattgccgcgagcgtaaaacgtgattatcaacaaaatcgcgtggcgcgttgggcagatgatcaaaaaattgtcggtcaggccgatcccgtggcttgggtcagtttgcaggacattcagggtaaagatgataaatggtcagtaccgctaaccgtgcgtggtaaaagtgccgatattcattaccaggtcagcgtggactgcaaagcgggaatggcggaatatcagcggcgtactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K748002_sequence 1 atgacacatgaacattcagcacaatggttgaataattacaaaaaaggatatggttacggtccttatccattaggtataaatggcggtatgcactacggagttgatttttttatgaatattggaacaccagtaaaagctatttcaagcggaaaaatagttgaagctggttggagtaattacggaggaggtaatcaaataggtcttattgaaaatgatggagtgcatagacaatggtatatgcatctaagtaaatataatgttaaagtaggagattatgtcaaagctggtcaaataatcggttggtctggaagcactggttattctacagcaccacatttacacttccaaagaatggttaattcattttcaaattcaactgcccaagatccaatgcctttcttaaagagcgcaggatatggaaaagcaggtggtacagtaactccaacgccgaatacaggttggaaaacaaacaaatatggcacactatataaatcagagtcagctagcttcacacctaatacagatataataacaagaacgactggtccatttagaagcatgccgcagtcaggagtcttaaaagcaggtcaaacaattcattatgatgaagtgatgaaacaagacggtcatgtttgggtaggttatacaggtaacagtggccaacgtatttacttgcctgtaagaacatggaataaatctactaatactttaggtgttctttggggaactataaagtaataa BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z