BBa_K1514001 1 BBa_K1514001 hemiCherry_B 2014-10-08T11:00:00Z 2015-05-08T01:10:48Z Sequence obtained from Parts Registry entry BBa_K180008 and split on a loop region between D158 and G159. This part is the second half of a split version of the red fluorescent protein mCherry (part A here). By itself, each part does not emit fluorescence, but once they are brought together (i.e., by being associated in fusion proteins with domains that bind to each other), emission peak at 610nm can be measured under excitation at 587nm. false false _1894_ 0 16458 9 Not in stock false First 158 amino acids removed from the original mCherry sequence. false Carlos Goncalves BBa_K1514001_sequence 1 ggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z