BBa_K1514003 1 BBa_K1514003 TAL-Protein_GT6_Direpeat_RFC25 2014-10-15T11:00:00Z 2015-05-08T01:10:48Z This part's sequence was obtained from the Parts Registry entry BBa_K747011. This part can be used to synthesize a 12 nucleotide Transactivator-like (TAL) protein, i.e. DNA-binding proteins, as long as the sequence it binds ends with GT. It has the same sequence of [[http://parts.igem.org/Part:BBa_K747091 BBa_K747091]], but was inserted between RFC25 preffix and suffix, allowing it to be used on any fusion protein and in a standard iGEM vector. false false _1894_ 0 16458 9 Not in stock false This sequence is flanked by RFC25 preffix and suffix. false Carlos Goncalves BBa_K1514003_sequence 1 cgtctcacctgaccccggaacaggtggtggccattgcttccaataacggtggcaaacaggctctggaaaccgtgcaacgcttgctgccagtcctttgccaggcccatggtttgacaccggagcaggttgtggctattgccagcaacggtggcggtaaacaggccctggagactgtgcagcgcctgctcccagtgctgtgtcaggcccacgga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z