BBa_K1514004 1 BBa_K1514004 PHO1 Yeast Secretion Domain 2014-10-16T11:00:00Z 2015-05-08T01:10:48Z Hashimoto Y, Koyabu N, Imoto T. Effects of signal sequences on the secretion of hen lysozyme byyeast: construction of four secretion cassette vectors. Protein Eng. 1998 Feb;11(2):75-7. PMID: 9605540 This part is a secretion domain obtained from the Saccharomyces cerevisiae acid phosphatase 1. If assembled to the N-terminal of a fusion protein, it will cause the protein to be secreted by the yeast. false false _1894_ 0 16458 9 Not in stock false This sequence is flanked by RFC25 preffix and suffix. false Carlos Goncalves BBa_K1514004_sequence 1 atgttctctccaattttgtccttggaaattattttagctttggctactttgcaatctgtcttcgct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z