BBa_K1514005 1 BBa_K1514005 TOR-A TAT signaling domain for bacteria 2014-10-16T11:00:00Z 2015-05-08T01:10:48Z Sequence obtained from the N-terminal of the TOR-A protein sequence acquired from NCBI. This part is a protein domain containing the twin-arginine translocation tag obtained from the TOR-A protein of Escherichia coli. This N-terminal domain causes the protein to be translocated into the periplasmic space, from where it is secreted onto the extracellular medium. false false _1894_ 0 16458 9 Not in stock false This part is flanked by RFC25 preffix and suffix. false Carlos Goncalves BBa_K1514005_sequence 1 atgaacaataacgatctctttcaggcatcacgtcggcgttttctggcacaactcggcggcttaaccgtcgccgggatgctggggccgtcattgttaacgccgcgacgtgcgactgcggcgcaagcggcgactgacgctgtcatctcgaaagagggcatt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z