BBa_K1519007 1 BBa_K1519007 OsmY 2014-10-08T11:00:00Z 2015-05-08T01:10:48Z DH5a E. coli Osmotically Hyperinducible Protein Y (OsmY) is an E. coli gene utilized for osmotic regulation. Previous work has shown OsmY to be capable of functioning as a secretion tag when fused to a second protein of interest. The pathway of secretion for OsmY is unknown, but work has hinted towards the Sec pathway as the mechanism of secretion for this protein. However, unlike Sec-pathway secretion, OsmY fusions have been reported to also be secreted out of the periplasm into the growth medium, a unique function of this protein that allows for many applications moving forward. false false _1901_ 0 18524 9 In stock false Previous work has shown N-terminal OsmY fusions to function less efficiently than C-terminal. However, as the pathway of secretion is unknown, support for this observation is not justified false Drew Dunham BBa_K1519007_sequence 1 atgactatgacaagactgaagatttcgaaaactctgctggctgtaatgttgacctctgccgtcgcgaccggctctgcctacgcggaaaacaacgcgcagactaccaatgaaagcgcagggcaaaaagtcgatagctctatgaataaagtcggtaatttcatggatgacagcgccatcaccgcgaaagtgaaggcggccctggtggatcatgacaacatcaagagcaccgatatctctgtaaaaaccgatcaaaaagtcgtgaccctgagcggtttcgttgaaagccaggcccaggccgaagaggcagtgaaagtggcgaaaggcgttgaaggggtgacctctgtcagcgacaaactgcacgttcgcgacgctaaagaaggctcggtgaagggctacgcgggtgacaccgccaccaccagtgaaatcaaagccaaactgctggcggacgatatcgtcccttcccgtcatgtgaaagttgaaaccaccgacggcgtggttcagctctccggtaccgtcgattctcaggcacaaagtgaccgtgctgaaagtatcgccaaagcggtagatggtgtgaaaagcgttaaaaatgatctgaaaactaagtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z