BBa_I712074 1 BBa_I712074 T7 promoter (strong promoter from T7 bacteriophage) 2007-10-21T11:00:00Z 2015-08-31T04:07:46Z T7 bacteriophage T7 promoter is very specific promoter which is transcribed only by specific T7 RNA polymerase. Usually this promoter is used in expression systems where T7 promoter is cotransfected with T7 RNA polymerase. That ensures strong transcription of desired genes. false false _130_ 0 1856 9 In stock false true Rok Gaber BBa_K1519008 1 BBa_K1519008 OsmY based secretion for purification 2014-10-08T11:00:00Z 2015-05-08T01:10:48Z OsmY comes from the MG1655 E.coli strain. By inserting the DNA sequence of a desired protein in our part, you will be able to secret your protein, bind it to a Nickel column, and cleave off the desired protein from the tag in very few steps. The OsmY-tag will allow you to have your protein fold in the periplam and form disulfide bonds. Once folded OsmY also allows the portein to be secreted into the media, which contains significantly less portion of endesired protein. The media containing the construct can there be run through a nickel column for further purification. Once elluted from the column, one can add TEV-His protease to cleave the tag off the desired protein. By re-running the protein in a nickel column, the desired portein will elute directly, while the tag and the TEV-His will stay bound to the column. false false _1901_ 0 18972 9 In stock false None. false Raoul Martin component2407967 1 BBa_I712074 annotation2407967 1 BBa_I712074 range2407967 1 1 46 BBa_K1519008_sequence 1 taatacgactcactatagggaatacaagctacttgttctttttgca BBa_I712074_sequence 1 taatacgactcactatagggaatacaagctacttgttctttttgca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z