BBa_K1520001 1 BBa_K1520001 Riboswitch MC7 2014-09-21T11:00:00Z 2015-05-08T01:10:48Z The aptamers are from results of paper, In vitro selection of specific aptamers against microcysitin-LR. The whole riboswitches are designed. It is a riboswitch designed by our team. We design a lot of riboswitch for microcystin, and then choose two excellent ones, MC7 and MC31, by modeling. They are riboswitches based on the stability of mRNA. The structure of them include a hammerhead ribozyme and a microcystin aptamer. Users can connect them down the promoter to use them. false false _1902_ 0 21318 9 Not in stock false We tested a lot of riboswitches by model and experiment to choose better one. false Xiaoman Xi BBa_K1520001_sequence 1 aaacaaacaaagctgtcaccggatgtgctttccggtctgatgagtccgtgtccggtggacagaaaaggggaatagtggaagacgtgtatcgcgggacgggacgaggacgaaacagcaaaaagaaaaataaaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z