BBa_K152009 1 BBa_K152009 Zea mays Actin1 Intron RNAi Production Tool 2008-10-30T12:00:00Z 2015-05-08T01:10:49Z Template free PCR using two complimentary primers donated by IDT: one 60 bp long, and the other 200 bp long. This short construct was designed to allow ANY biobrick (likely size dependant) to be used in the production of an RNAi construct for expression in bacteria. It replaces the standard biobrick restriction site conformation with an altered one for sense (EcoRI and XbaI) and antisense (NotI and SpeI) fragment placement. The small 100 bp intron the the Actin1 gene (Genebank Index 168403) of Zea mays was picked as the heart of this construct since plant RNAi constructs with hairpin loops made by introns produce much higher rates of transcriptional silencing [Nature 407, 319-320 (21 September 2000)]. On either side of the intron are cloning sites for sense and antisense fragments. The antisense fragment has to be inserted first, by cutting the plasmid with NotI and SpeI, while cutting the antisense fragment with NotI and XbaI and ligating them together. Next, the sense fragment is meant to be inserted by cutting the RNAi construction tool (now containing the same fragment in the antisense orientation) with EcoRI and Xba, while cutting the sense fragment with EcoRI and SpeI and ligating the two together. As there is a transcriptional termination signal programmed into the 3' end, all this needs now is a promoter and double stranded RNA should be churned out large amounts by your bacteria of choice. Note: the intron was reprogrammed to contain an efficient rbs and NcoI and AvrII restriction sites for the possible inclusion of a reporter gene in the loop region of the construct. false false _233_ 0 2886 9 It's complicated true In order to utilize existing biobricks to make RNAi constructs, it was necessary to re-organize restriction site placement. The part is housed in the Biobrick plasmid pSB1A2 which was cut with EcoRI and PstI, and ligated to the MfeI and PstI cut RNAi tool. The PstI site was conserved, but MfeI and EcoRI are non-conservative compatible ends and so the plasmid's EcoRI site was killed allowing the construct's intrenal EcoRI site to be unique. The construct ends up having this structure: NdeI - EcoRI - XbaI - Intron - NotI - SpeI - Terminator - PstI true David Johnston Monje BBa_K152009_sequence 1 ttgatcatatgatgaattccattctagacaactggtaagatggctgtcgcctcagatatatatagtgatatgcactacaaagaggaggatagtccatggcactacaacctaggtctctttgtcaaatatctctgtgtgcaggtattgtgatggactagtatgcggccgcatgaggaggaaaaaaaaaccccgcccctgacagggcggggttttttttctgcagaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z