BBa_K152012 1 BBa_K152012 Zea mays Actin1 Intron Reverse Primer 2008-10-30T12:00:00Z 2015-05-08T01:10:49Z Primer synthesis company This reverse primer binds in the middle of the intron, for use in assaying for construct presence using PCR. Combine with a primer for the promoter you are planning on using to drive RNAi construct expression. false false _233_ 0 2886 9 It's complicated false No false David Johnston Monje BBa_K152012_sequence 1 tgccatggactatcctcctc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z