BBa_K1521000 1 BBa_K1521000 Quorum threshold expression element (qteE) from Pseudomonas aeruginosa + SpoVg RBS 2014-09-30T11:00:00Z 2015-05-08T01:10:49Z This sequence was amplified through PCR from the Pseudomonas Aeruginosa PA14 cDNA. The qteE is the main quorum sensing regulator in Pseudomonas Aeruginosa. In this bacteria it is expressed as a constitutive protein that interacts with other quorum sensing proteins, such as LasR, inhibiting them from their regulation role (inducer, inhibitor and other functions). Assemblying this protein with specific promoters we are able to control the quorum sensing threshold, which is and interesting feature for pathways activation control. Moreover, if we assemble the qteE with an inducible promoter like Plac, it is possible to induce it with different IPTG concentrations, creating distinct threshold for protein production screening and even quantitative purposes. This conding sequence comes with the SpoVg RBS (BBa_K143021) for usage in Bacillus subtilis. We tested it in E. coli and it worked as well. false false _1903_ 0 21188 9 In stock false For appropriate use of this part as a threshold producer its important to test the molar ratio qteE:QSprotein in wich the inhibition caused by the QteE is on the verge of disappearing, so that you can set the threshold for your purpose correctly. If your putting qteE production under a inducible/repressible promoter it would be wise to do a concentration gradient for determination of the appropriate threshold. false Danilo Keiji Zampronio annotation2391398 1 SpoVg RBS range2391398 1 1 12 annotation2391399 1 qteE range2391399 1 19 591 BBa_K1521000_sequence 1 aaaggtggtgaatactagatgcttatccatttctgccccaggctgctgacgcctgcggggttcgacctgccgtgcgagctgatcgacatccgcatcaaggagttcgacctgcacctgcttggcgggcgcgacgtggtggcgcgtcaccccctccccgacaagcgctaccacgtggcctgccgcaagtccggctgcaaggcggtgaatggcctgctggtggacgtggaaaagcacgttccgctgttcaccgtggacacccgctggagcatcgacgccgaagtggtcctgcgccatcgcgtcgagtacgtggtgctcgacgccgagcacgacgcggtgagcgactacatgctgttgtggtgcgacgaggtgcccaactacttcctcggccagagcaccccggccatgcaggttccgttgatggaactgatgcgcggcaatgcgttgcagaccgagcggcaggatgtgttccgcctgccaacgctgaggtccgaacgcctgcgccagggcaacgccgatgccaaccagcatcttccgagccgtgagcaggcgttccacgtcaaggccgagcagatcagctatgggctggcctga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z