BBa_K1521001 1 BBa_K1521001 RBS SpoVG (K143021) + lasR 2014-09-30T11:00:00Z 2015-05-08T01:10:49Z This part was obtaind through PCR of the part C0079. We also removed the LVA tag and added the RBS SpoVG (K143021). This is an assembly os the biobricks SpoVG (K143021) for Bacillus subtilis and the LasR protein cds. Note that the lasR sequence was obtained through PCR of the part C0079 and that its LVA tag was also removed. Although the RBS was designed for B. subtilis also works on E. coli. This protein requires an HSL (homoserine lactone) produced by the gene lasI (C0078) to work appropriately. If you want the lasI is already available with RBS, cds, terminator and a promoter responsive to LasR (K081001). false false _1903_ 0 21188 9 It's complicated false This protein requires an HSL (homoserine lactone) produced by the gene lasI (C0078) to work appropriately. If you want the lasI is already available with RBS, cds, terminator and a promoter responsive to LasR (K081001). false Danilo Keiji Zampronio annotation2391930 1 cds range2391930 1 19 738 annotation2391929 1 rbs range2391929 1 1 12 BBa_K1521001_sequence 1 aaaggtggtgaatactagatggccttggttgacggttttcttgagctggaacgctcaagtggaaaattggagtggagcgccatcctccagaagatggcgagcgaccttggattctcgaagatcctgttcggcctgttgcctaaggacagccaggactacgagaacgccttcatcgtcggcaactacccggccgcctggcgcgagcattacgaccgggctggctacgcgcgggtcgacccgacggtcagtcactgtacccagagcgtactgccgattttctgggaaccgtccatctaccagacgcgaaagcagcacgagttcttcgaggaagcctcggccgccggcctggtgtatgggctgaccatgccgctgcatggtgctcgcggcgaactcggcgcgctgagcctcagcgtggaagcggaaaaccgggccgaggccaaccgtttcatagagtcggtcctgccgaccctgtggatgctcaaagactacgcactgcaaagcggtgccggactggccttcgaacatccggtcagcaaaccggtggttctgaccagccgggagaaggaagtgttgcagtggtgcgccatcggcaagaccagttgggagatatcggttatctgcaactgctcggaagccaatgtgaacttccatatgggaaatattcggcggaagttcggtgtgacctcccgccgcgtagcggccattatggccgttaatttgggtcttattactctctga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z